ID: 902051281

View in Genome Browser
Species Human (GRCh38)
Location 1:13565408-13565430
Sequence CAAGCAGTTTCTCAGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 135, 1: 91, 2: 67, 3: 48, 4: 289}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902051275_902051281 11 Left 902051275 1:13565374-13565396 CCAATAAAGACCGGCCTTTATTA No data
Right 902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG 0: 135
1: 91
2: 67
3: 48
4: 289
902051272_902051281 26 Left 902051272 1:13565359-13565381 CCACCTCTATACTGTCCAATAAA No data
Right 902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG 0: 135
1: 91
2: 67
3: 48
4: 289
902051277_902051281 -3 Left 902051277 1:13565388-13565410 CCTTTATTAGTCAAATCACCCAA 0: 106
1: 555
2: 156
3: 48
4: 152
Right 902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG 0: 135
1: 91
2: 67
3: 48
4: 289
902051273_902051281 23 Left 902051273 1:13565362-13565384 CCTCTATACTGTCCAATAAAGAC No data
Right 902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG 0: 135
1: 91
2: 67
3: 48
4: 289
902051271_902051281 27 Left 902051271 1:13565358-13565380 CCCACCTCTATACTGTCCAATAA No data
Right 902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG 0: 135
1: 91
2: 67
3: 48
4: 289
902051276_902051281 1 Left 902051276 1:13565384-13565406 CCGGCCTTTATTAGTCAAATCAC 0: 78
1: 371
2: 124
3: 44
4: 165
Right 902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG 0: 135
1: 91
2: 67
3: 48
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902051281 Original CRISPR CAAGCAGTTTCTCAGGCTCT TGG Intergenic
900034341 1:394486-394508 CAGGCACTGTGTCAGGCTCTTGG - Intergenic
900055175 1:624378-624400 CAGGCACTGTGTCAGGCTCTTGG - Intergenic
900722132 1:4183775-4183797 CACCTAGTTTCTCAGGCTCTTGG - Intergenic
900841189 1:5049838-5049860 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
901008438 1:6183397-6183419 CAAGGATTTTCTCAGGTTCAGGG - Intronic
901949011 1:12726527-12726549 CCCGCTGTTTCTCAGCCTCTGGG + Exonic
902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
903704734 1:25277383-25277405 AATGCAGATTCTCAGGCCCTAGG + Intronic
903722499 1:25415941-25415963 AATGCAGATTCTCAGGCCCTAGG - Intronic
904711958 1:32436771-32436793 CAAGCAGTTTTTCATGCTCTTGG + Intergenic
905926309 1:41752343-41752365 CAAGCAGCTCAGCAGGCTCTGGG + Intronic
906081242 1:43089907-43089929 CAAGCAGTTTCTCATGCTCTTGG + Intergenic
907006655 1:50921330-50921352 CAAGCTGATTCTCAGGCTCTTGG - Intronic
907417900 1:54327053-54327075 TAAGCAGTAACTCAGGCACTTGG + Intronic
907504816 1:54910445-54910467 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
908378728 1:63573899-63573921 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
908884724 1:68775470-68775492 AATGCACATTCTCAGGCTCTAGG + Intergenic
909729894 1:78877655-78877677 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
909760719 1:79283139-79283161 AAAGTAGTTTCTCAGCATCTTGG + Intergenic
910002372 1:82355822-82355844 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
910100955 1:83576294-83576316 TAAGCAGTTTGGCAGTCTCTTGG - Intergenic
911071582 1:93835970-93835992 CACCCAGTTTCTCAGGCTCTTGG + Intronic
911147567 1:94567521-94567543 GAAGCAGTTTCTCAGGCTCTTGG - Intergenic
911790209 1:102005552-102005574 CAATAAGTTTCTCAGTCTTTAGG - Intergenic
911984267 1:104601145-104601167 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
912329914 1:108810183-108810205 CATGAAGTTTTTCAGGTTCTAGG + Intergenic
912755736 1:112323522-112323544 CCAGCAGGTTCCCAGGGTCTTGG - Intergenic
912813914 1:112813882-112813904 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
912814909 1:112821340-112821362 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
912939293 1:114030847-114030869 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
913238886 1:116810626-116810648 CATGCAGCTTCCCTGGCTCTGGG - Intergenic
913245595 1:116867467-116867489 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
913655652 1:120957188-120957210 CGAGCAGTTTCTCAGGCTCTTGG - Intergenic
914256622 1:145965043-145965065 ACAGGAGTTTGTCAGGCTCTTGG - Intronic
915341316 1:155178393-155178415 AAAGCAGTTCCCAAGGCTCTAGG + Intronic
915604218 1:156940561-156940583 CCAGCACTGTCCCAGGCTCTTGG + Intronic
915969247 1:160342021-160342043 TGAGCAGTTTCTAAGTCTCTTGG - Intronic
916318521 1:163477621-163477643 AAAGCAGTTTCTGAAGTTCTAGG + Intergenic
916329200 1:163595549-163595571 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
916795241 1:168161244-168161266 AGAGCTGTTTCTCAGGCCCTGGG + Intergenic
916942043 1:169686603-169686625 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
917750071 1:178044951-178044973 CAAGCAATTTCTCAGGCTCTTGG + Intergenic
918209897 1:182341231-182341253 CATACAATTTCTCAGCCTCTTGG + Intergenic
920259476 1:204679141-204679163 CAGGCACTTTCTCAGGCTCGAGG + Intronic
920287533 1:204891292-204891314 CAACCAGTGGCTCAGGCTATTGG + Intronic
920426909 1:205885817-205885839 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
920901187 1:210111995-210112017 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
920908464 1:210192476-210192498 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
921052872 1:211523582-211523604 CTAGGACTTTCTCTGGCTCTGGG + Intergenic
921205545 1:212845534-212845556 TGAGCAATTTCTCAGGCTCTTGG + Intronic
921520388 1:216149372-216149394 AAAGCAGTTTCTCAGGCTCTTGG + Intronic
922256694 1:223898683-223898705 CAGGCACTGTGTCAGGCTCTTGG - Intergenic
922363142 1:224841171-224841193 CAAGCAGTTTCTCAGGCTGTTGG - Intergenic
922368908 1:224890410-224890432 CAAGCAGTCTCCCAGGCCCTTGG + Intergenic
922528511 1:226325186-226325208 CCACCAGGTTCTCAGGCTTTGGG - Intergenic
922845004 1:228677819-228677841 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
923075551 1:230605829-230605851 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
923688065 1:236167758-236167780 CAAGCAGGGGCTCAGGCTCATGG - Intronic
923963115 1:239105795-239105817 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
924181023 1:241438616-241438638 CCAGCAGTTTTTCAGGCTCTTGG + Intergenic
924337902 1:243001536-243001558 CAGGCACTGTGTCAGGCTCTTGG - Intergenic
1062867962 10:872923-872945 CAAGGATTTTCGCAGGGTCTGGG - Intronic
1063026028 10:2179484-2179506 CAACCAGTGTGTCAAGCTCTGGG - Intergenic
1063223149 10:3989677-3989699 AACGCATTTTCTCAGGCTCTGGG + Intergenic
1064532568 10:16325089-16325111 CTAGCAGTTACTCATGCTCTGGG + Intergenic
1064720583 10:18225099-18225121 CCTGCTGTTTCTCAGGCTTTTGG + Intronic
1064721918 10:18237505-18237527 CATGCCATTTCTGAGGCTCTAGG - Intronic
1065071896 10:22033280-22033302 CAGGCAGTTTCTCCAGCACTTGG - Intergenic
1065438049 10:25721652-25721674 CAAGCATTTTTACGGGCTCTTGG + Intergenic
1066436728 10:35402841-35402863 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1067997544 10:51291352-51291374 GAAGTAGTTTCTCTGTCTCTGGG + Intronic
1068091068 10:52432756-52432778 CAAAGAGTGTCTCAGGATCTGGG + Intergenic
1068324637 10:55468115-55468137 CAAGCAGTTTCTCAAGAGCAGGG + Intronic
1068721854 10:60254504-60254526 TAAGCAGGGCCTCAGGCTCTGGG - Intronic
1069574288 10:69515876-69515898 CAGGCAGGTGCCCAGGCTCTAGG - Intergenic
1070893867 10:79964998-79965020 CAAACAGTTTCTCAGGCTTTTGG + Intronic
1070953798 10:80451703-80451725 GAAACATTTTCTCAGTCTCTGGG + Intergenic
1071822149 10:89289656-89289678 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1072010939 10:91302486-91302508 CAAGCAGTTTTTCAGGCTGTTGG - Intergenic
1073014463 10:100386889-100386911 CAAGCAGCTTCTCAGCCTCTTGG + Intergenic
1073130513 10:101185946-101185968 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1073436676 10:103521196-103521218 CAAGCAGTTTCTCGGGCTTTGGG - Intronic
1073477958 10:103766837-103766859 TGAGGAGTTTCTCAGGCTCCTGG - Intronic
1073683905 10:105732180-105732202 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1075014343 10:118899207-118899229 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1075853034 10:125604005-125604027 CAAGCACTTTCTGAGCTTCTCGG - Intronic
1076146320 10:128125584-128125606 CAAGCAGGTGCTGAGGCTCAGGG + Exonic
1077180342 11:1209447-1209469 CATGCCCTTCCTCAGGCTCTGGG + Intergenic
1077419058 11:2441064-2441086 CCAGAAGGTTCTGAGGCTCTGGG + Intergenic
1077551272 11:3201369-3201391 CCCCCGGTTTCTCAGGCTCTGGG - Intergenic
1078069780 11:8100822-8100844 CTAGCAGTGTCTCATGCTCCTGG - Exonic
1078789453 11:14527773-14527795 ACCTCAGTTTCTCAGGCTCTTGG + Intronic
1079230945 11:18648194-18648216 ACCTCAGTTTCTCAGGCTCTTGG + Intergenic
1079386924 11:19988817-19988839 CAAGCAGTGTCCTGGGCTCTTGG - Intronic
1079835594 11:25328940-25328962 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1079847244 11:25487735-25487757 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
1080203860 11:29706647-29706669 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1081404638 11:42682889-42682911 CAAGCATTTTGTCAGGCCTTGGG + Intergenic
1081583494 11:44368251-44368273 CAAGCATGCTCTTAGGCTCTGGG + Intergenic
1082197347 11:49322164-49322186 CAAGCAGTTTCTCAGACTCTTGG - Intergenic
1082633029 11:55562807-55562829 CAAGCCATCTCTCAGGCTCTTGG + Intergenic
1082793844 11:57365958-57365980 GAATCAGTTTCTCAGGCCCCTGG + Intronic
1083962011 11:66019952-66019974 CAAGCAGTTTAACTGGCTTTGGG + Intronic
1084354637 11:68629565-68629587 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1084585433 11:70058846-70058868 CAAGCCGTCTCTCAGGCTCTCGG - Intergenic
1085934603 11:81126214-81126236 CATGCATTTTTTCAGGCTCTTGG + Intergenic
1085988430 11:81811403-81811425 CAAGCATTTTTTCAGGCTCTTGG + Intergenic
1086134376 11:83431888-83431910 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1086135845 11:83443379-83443401 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1086191412 11:84083746-84083768 AAAGAAGTTTCTTAGGCTCATGG - Intronic
1086550635 11:88048365-88048387 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1086658470 11:89385960-89385982 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1086960818 11:92978798-92978820 CAAGCTGTTTGCCAGCCTCTGGG + Intronic
1087099994 11:94354273-94354295 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1087129483 11:94655924-94655946 CAAGGGGTTGCTAAGGCTCTTGG + Intergenic
1087167650 11:95021118-95021140 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1087197314 11:95314497-95314519 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1087839181 11:102905153-102905175 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1089286727 11:117412216-117412238 CAGGCAGCTCCTCAGGCACTTGG - Exonic
1089927499 11:122273905-122273927 CAAGCAGTTACAGAGGATCTAGG + Intergenic
1089953770 11:122552317-122552339 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1089988001 11:122831546-122831568 CAAGCAGGTTTTCAGGCTCTTGG + Intergenic
1090107213 11:123866557-123866579 CAAGCAGGTTTTCAGGCTCTTGG - Intergenic
1090526443 11:127543805-127543827 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
1090654004 11:128828729-128828751 GCAGTAGTTTCTGAGGCTCTCGG + Intergenic
1090834550 11:130444701-130444723 CCAGCACTGTGTCAGGCTCTGGG + Intergenic
1090926606 11:131255773-131255795 CAAGCATTTTTTTAGGCTCTTGG - Intergenic
1091184034 11:133631431-133631453 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1091514954 12:1169754-1169776 CAAGTAGTTTTTCAGAGTCTTGG + Intronic
1091692138 12:2604574-2604596 CAGGCAGTTTCTCAAGCACATGG + Intronic
1093160335 12:15739623-15739645 CCTGCAGCTCCTCAGGCTCTTGG + Intronic
1093302976 12:17477415-17477437 CAAGCCATCTCTCAGGCTCCTGG + Intergenic
1093321657 12:17721486-17721508 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
1093358894 12:18200389-18200411 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1093884349 12:24442321-24442343 CAGGCATTATTTCAGGCTCTAGG + Intergenic
1094025566 12:25957813-25957835 CATGCAATTACTCAGGCACTGGG - Intergenic
1094401107 12:30061177-30061199 CAAGCATTTTTTCAGGCTCTTGG + Intergenic
1094826188 12:34270922-34270944 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1094871689 12:34602427-34602449 GAAGGAGTTTCTCAGGCCCACGG + Intergenic
1095739171 12:45588335-45588357 CAACCCGGTTCTCAGGCCCTTGG + Intergenic
1095778623 12:46035287-46035309 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1095806328 12:46324455-46324477 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1095969566 12:47892311-47892333 CATGCAGCTTCTCAGGACCTGGG + Intronic
1096649670 12:53055854-53055876 GAAGCAGCTACTCAGGCGCTGGG - Intronic
1096906853 12:54944126-54944148 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1097521697 12:60678890-60678912 CAGGCTGTTTCTCAGGTGCTGGG + Intergenic
1097541766 12:60952495-60952517 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
1097592767 12:61591850-61591872 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1098653464 12:73003084-73003106 CAACCAGTTTTTTAGGCTCTTGG - Intergenic
1098920350 12:76296794-76296816 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1099291770 12:80784362-80784384 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
1099390880 12:82077791-82077813 CAGGCAGTTTCTCAGGTTGGGGG + Intergenic
1100090945 12:90970372-90970394 CAATGTGTTTCTCAGTCTCTAGG + Intronic
1100940732 12:99720465-99720487 CAAGCAGTTTTTCAGGCTCTTGG + Intronic
1102116337 12:110406016-110406038 GAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1102604955 12:114061187-114061209 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1104958652 12:132477847-132477869 CAGGCAGATCCTCAGGCTGTGGG - Intergenic
1106249008 13:27970084-27970106 AAAGCAGTTTCTTAGGCTGCTGG + Exonic
1107219929 13:37970252-37970274 CAAGCAGTTTTTCAGGCTCCTGG - Intergenic
1107324801 13:39230226-39230248 CAAGCAGTTTTCTGGGCTCTGGG + Intergenic
1107381842 13:39864906-39864928 CAAGCAGATACTGAGGCTCCAGG + Intergenic
1107424924 13:40283310-40283332 CATTCAGTTTCCTAGGCTCTGGG + Intergenic
1107702327 13:43060725-43060747 CAAGCTGTTTCTCAGGCTCTTGG - Intronic
1108281622 13:48867645-48867667 CAAGAAGTTTGTCAGGCTCTTGG - Intergenic
1108386600 13:49904813-49904835 TAAATAATTTCTCAGGCTCTGGG - Intergenic
1108493229 13:51001374-51001396 CAACCTGCTTCTCAGGCTCCAGG - Intergenic
1108702873 13:52958662-52958684 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1110304521 13:73969688-73969710 CAAGCAGTATCCCAGGGACTGGG - Intronic
1110332856 13:74292911-74292933 CAAGCACTTTTCTAGGCTCTGGG - Intergenic
1112361835 13:98725648-98725670 CAGGCACTGTTTCAGGCTCTAGG + Intronic
1113752063 13:112783431-112783453 CCAGCACTTTCTCAGGGTCCTGG - Intronic
1114234955 14:20815504-20815526 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1114484724 14:23055866-23055888 CAAGCAGCTGCTCAGGCTCAAGG + Intronic
1114737412 14:25056798-25056820 CTAGCAGTTCTTCTGGCTCTTGG - Intergenic
1115182952 14:30651384-30651406 CAAGCAGTTTATAAGGCTGTAGG - Intronic
1115359203 14:32482620-32482642 CAAGCACTTTTCCAGGCCCTTGG - Intronic
1115905132 14:38195210-38195232 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1116490200 14:45496125-45496147 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
1116613755 14:47108010-47108032 CAAGCAGTTTTTCAGGCTCTTGG + Intronic
1116702034 14:48256447-48256469 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1117898326 14:60509686-60509708 CACGCAGCTTCTCAGCCTCCTGG - Exonic
1119342218 14:73888949-73888971 CGAGCATTTTCTCAAGCACTGGG - Intronic
1119386169 14:74259185-74259207 CTAGCAGTGTCTCTGGCTCAGGG - Intronic
1119559866 14:75581491-75581513 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1120251030 14:82062155-82062177 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
1120539156 14:85733684-85733706 CAAGCATTTCTTCAGGCTCTTGG - Intergenic
1120753459 14:88219431-88219453 CAGGCAGCTTCTCAGGCTCAGGG - Intronic
1121015022 14:90543946-90543968 CAGGTTGTCTCTCAGGCTCTTGG - Intronic
1121192850 14:92045286-92045308 CAAGCAGTTTCTCAGGCTCTTGG - Exonic
1121272691 14:92648645-92648667 CAAGCACTGTCTCAGGTGCTGGG + Intronic
1121389563 14:93562637-93562659 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1121395647 14:93620539-93620561 CAAGCAGTGTCACAGGCTCCTGG + Intronic
1121980206 14:98448003-98448025 CAAGCAGTTTCTCAGGTTCTTGG - Intergenic
1122041321 14:98989628-98989650 CAAGCAGTTCCTCAGGCTCTTGG + Intergenic
1122380933 14:101306520-101306542 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1122508079 14:102244819-102244841 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1123882145 15:24686602-24686624 CAACCAGCTTTTTAGGCTCTTGG - Intergenic
1124511098 15:30326596-30326618 AAAGCAGTTTCTTTGGCTCATGG - Intergenic
1124611857 15:31214909-31214931 CAGGCCTCTTCTCAGGCTCTGGG - Intergenic
1124731816 15:32204169-32204191 AAAGCAGTTTCTTTGGCTCATGG + Intergenic
1125473919 15:40031407-40031429 CTAGCTGTTTCTCAGGATTTGGG + Intronic
1125596978 15:40893661-40893683 CAAGCACTGTTCCAGGCTCTGGG - Intergenic
1125849482 15:42889448-42889470 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1126112857 15:45185882-45185904 CAAGCATTGTGTCAGGCACTTGG + Intronic
1126844192 15:52743918-52743940 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1127891136 15:63252275-63252297 CAAGCTATGTCCCAGGCTCTAGG + Intronic
1128476916 15:68005241-68005263 CCAGCAGCTTCTCAGCTTCTGGG - Intergenic
1128772448 15:70292369-70292391 CATGCAGTTTGCCAGGCTCTGGG - Intergenic
1128882961 15:71260441-71260463 CAAGCAGTTTCCCATAATCTGGG - Intronic
1129259813 15:74358812-74358834 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1130299368 15:82668133-82668155 AAAGCAGCTGCTCAGACTCTGGG - Intronic
1130304948 15:82707151-82707173 CAAGCAGTTTCTCAGGCTCCTGG + Intronic
1131071369 15:89468307-89468329 CAAGGGGTTGCTAAGGCTCTTGG + Intergenic
1131165137 15:90136660-90136682 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1131448099 15:92516147-92516169 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1131685080 15:94759112-94759134 CAAGCATTTTTTCAGGCTCTTGG + Intergenic
1131728312 15:95251426-95251448 CAGGCACTTTCACAGGCACTGGG + Intergenic
1131734499 15:95317636-95317658 CATGCAGTATTTCAAGCTCTTGG - Intergenic
1132295563 15:100731731-100731753 CATTCATTTTCTCAAGCTCTGGG - Intergenic
1133054596 16:3139214-3139236 AAAGGAGTTACTCAGGCTCCTGG - Intronic
1133939157 16:10293998-10294020 CAAGCAGTTTCTCAGGATCTTGG + Intergenic
1134099310 16:11440458-11440480 CATGCAGTCTCTCAGGATCCAGG - Intronic
1134254217 16:12598455-12598477 AAAGCTGTTTCCCAGCCTCTTGG + Intergenic
1134790303 16:16983647-16983669 CAAGCGGTTGCTAAGGCTGTTGG + Intergenic
1135591282 16:23706719-23706741 CCAGCTGTTCCTCAAGCTCTGGG - Intronic
1136569328 16:31087496-31087518 CAGGCAGGGTCTCCGGCTCTGGG - Intronic
1137363868 16:47843764-47843786 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1137867262 16:51913198-51913220 TCAGCAGTGTCTCAGCCTCTGGG + Intergenic
1137896245 16:52216137-52216159 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1137996546 16:53221094-53221116 CAAGCACTTTCCTAGGCTCTAGG - Intronic
1138537183 16:57666409-57666431 CATGCACTTTCCCAGGCTGTGGG + Intergenic
1138758675 16:59518230-59518252 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1141149318 16:81553111-81553133 CAAGCAGAGACTCAGGCCCTGGG - Intronic
1143936789 17:10494413-10494435 CAAGAATATTCTCAGGCTCCAGG - Exonic
1144586279 17:16489807-16489829 GCAGCAGGTCCTCAGGCTCTGGG - Intronic
1144842906 17:18199365-18199387 CCAGAAGTTTGTCAGCCTCTTGG - Intronic
1145322541 17:21774685-21774707 CAGTGAGTTTCTCTGGCTCTTGG + Intergenic
1145828972 17:27899456-27899478 CAAGCAGTTTTCTAGGTTCTGGG + Intergenic
1146549317 17:33766320-33766342 CAAGCAGCTGCTGAGGCTTTTGG + Intronic
1147535642 17:41320791-41320813 CAGGCATCTTCTCAGGTTCTGGG + Intergenic
1148126776 17:45241426-45241448 GAGGCGCTTTCTCAGGCTCTGGG - Exonic
1149220941 17:54414710-54414732 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1149320100 17:55473527-55473549 TAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1149731658 17:58952436-58952458 CAGCCTGTTTCTCAGGCCCTGGG + Intronic
1150576759 17:66437586-66437608 CAGGCAGGTCCTCTGGCTCTGGG - Intronic
1150986034 17:70197996-70198018 CAAGATGTTTCTCAGGATCTGGG - Intergenic
1151723184 17:75869859-75869881 CAAGCTCTTCCTCAGGCTGTTGG + Intergenic
1152270637 17:79322691-79322713 CAAGCAGCTTCTAGGGGTCTGGG + Intronic
1152334183 17:79690905-79690927 CATGGAGTTCCTCAGGCCCTAGG + Intergenic
1152454393 17:80404948-80404970 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1152512382 17:80799087-80799109 CAAGCAGGTTCTCTGGCTCTAGG - Intronic
1152731254 17:81971921-81971943 CAACCTGCTTCTCAGGCTTTTGG + Intergenic
1152813666 17:82394471-82394493 CCAGCAGCTTCACTGGCTCTCGG + Exonic
1153171727 18:2324498-2324520 GAAACTGTTTCTCAGGCTTTTGG - Intergenic
1153757268 18:8296985-8297007 CATTCAGTTTCACAGGCACTGGG - Intronic
1153897269 18:9577163-9577185 CAAGCAGCTTTTCAGTCTCTGGG - Exonic
1154045373 18:10899156-10899178 CAAGAAGTTACTCAACCTCTTGG + Intronic
1155174226 18:23288786-23288808 CAAGCAGGTTTTCAGGCTCTTGG + Intronic
1155578410 18:27275491-27275513 CAAGCTCATTCTCAGGCTATGGG + Intergenic
1155892357 18:31285451-31285473 CAAACAATTTCTCAGGCTCTTGG - Intergenic
1155941952 18:31808789-31808811 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1156483850 18:37452453-37452475 CAAGCAGTTTCTCTTTCCCTGGG + Intronic
1156916229 18:42466605-42466627 CAAGCAGTTTCTGAGGCTCTTGG + Intergenic
1156923711 18:42553639-42553661 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1156938851 18:42741082-42741104 CATGCAGTTTTTCAGGCTTTTGG + Intergenic
1156958556 18:42995542-42995564 CAAGCATTTTTTCAGGCTCTTGG + Intronic
1158576403 18:58642433-58642455 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1159929566 18:74296965-74296987 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1160794515 19:938714-938736 CCAGCAGCCTCTCAGGCTCAAGG + Intronic
1161456870 19:4373955-4373977 CATGCCGTCTCTCAGGCTGTCGG + Intronic
1161827162 19:6575736-6575758 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1162262689 19:9545599-9545621 CAAGCAGTCTCTCAGGCCTTGGG + Intergenic
1162287135 19:9747174-9747196 CAAGCAGTCTCCCAGGCCCTTGG + Intergenic
1163210128 19:15834151-15834173 TCCACAGTTTCTCAGGCTCTTGG + Intergenic
1163487619 19:17597858-17597880 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1163899750 19:20090968-20090990 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1163944052 19:20519775-20519797 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1164153377 19:22573229-22573251 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1164202075 19:23027359-23027381 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1164485918 19:28655402-28655424 CAAGGTGGTTCTCAGGCCCTGGG - Intergenic
1165166221 19:33859075-33859097 TAAGGAGTTTCCCAGACTCTGGG + Intergenic
1165581165 19:36865041-36865063 CAAGCAGCTTCTCTAGCTCCCGG - Intronic
1166059754 19:40318810-40318832 CATGCAGTGTCCCAGGCACTGGG - Intergenic
1166305272 19:41934018-41934040 CTGGCAGGTTCTCAGCCTCTTGG - Intergenic
1167917716 19:52755603-52755625 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1168207811 19:54865194-54865216 CTAGAAGTTGCCCAGGCTCTGGG - Intronic
1168211708 19:54895553-54895575 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1168248667 19:55128008-55128030 CAAGCAGTCTCTCAGGCTCTCGG + Intergenic
1168269635 19:55242389-55242411 CCAGCAGTTGGTCAGGCTCTGGG + Exonic
1168278997 19:55294026-55294048 AAAGCAGGTTCTCGGGCTTTAGG - Exonic
1168548394 19:57272862-57272884 CAGGCAGTATCTCTGGATCTGGG + Intergenic
927134547 2:20087186-20087208 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
928636368 2:33250970-33250992 CAGGCAGGTTCTCAGGCTCCTGG - Intronic
928779381 2:34802247-34802269 CAAGCATTTTTTTTGGCTCTTGG - Intergenic
928857511 2:35817519-35817541 CAAGCATTTTTTCAGGCTCTTGG + Intergenic
929684086 2:44019556-44019578 GAAGCAGTTTATCAGTCTCTTGG - Intergenic
930051715 2:47221150-47221172 CAAGTGGTTTCTCATCCTCTGGG - Intergenic
930098583 2:47585975-47585997 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
930706285 2:54508123-54508145 CAAGCAGTTTCTCAGGCTGTTGG - Intronic
932159047 2:69444255-69444277 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
933138348 2:78762853-78762875 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
934564503 2:95330805-95330827 CAGGCAATGTCCCAGGCTCTGGG + Intronic
935047537 2:99495537-99495559 CAAGCAGAGTCTCAGCCTCCTGG + Intergenic
937841997 2:126533650-126533672 CAAGCATTGTCAAAGGCTCTGGG + Intergenic
939460356 2:142490631-142490653 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
940107718 2:150117248-150117270 CAAGCATTTTTTCAGGCTCTTGG + Intergenic
940201219 2:151153020-151153042 CAAGCAGTCTTCTAGGCTCTTGG - Intergenic
940376628 2:152965555-152965577 CAAGCGGTTTCTAAGGCTTTAGG - Intergenic
940508419 2:154584190-154584212 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
940792851 2:158046429-158046451 CAAGCAGATTCTCTGGCTGGGGG - Intronic
941455736 2:165710843-165710865 CAAGTAGTTTCTCAGGCTCTTGG - Intergenic
941567176 2:167123833-167123855 CAAGCATATTCTCAGGTACTGGG + Intronic
941610292 2:167653462-167653484 CAAGCAGGTTCTCAGATGCTTGG - Intergenic
941751018 2:169135520-169135542 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
942729933 2:179052829-179052851 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
943061957 2:183048761-183048783 CAAGCAGTTTATAAGGCTCTTGG + Intergenic
943244300 2:185426004-185426026 CAACAACTTTCTCTGGCTCTTGG + Intergenic
943412531 2:187561203-187561225 CAAGCAATTTCTCAGGATCTTGG - Intronic
943450504 2:188037863-188037885 CAAGCATTTTTTCAGACTCTTGG + Intergenic
943460792 2:188169943-188169965 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
943730982 2:191303540-191303562 CAGGCAGTCTTTCAGGCACTGGG + Intronic
944251488 2:197583474-197583496 CCAGCAGTTTCTCAGGCTCTTGG + Intronic
945555091 2:211266428-211266450 CAAGCAGTTTCTCACGCTCATGG + Intergenic
945774009 2:214081994-214082016 CATCAAGTTCCTCAGGCTCTGGG + Intronic
946871319 2:224088303-224088325 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
947571004 2:231234342-231234364 CAAGCAGCTTAGAAGGCTCTAGG - Intronic
947842386 2:233216370-233216392 TGAGCAGTTTCTCAGGCTCTTGG - Intronic
1169175190 20:3505311-3505333 CGAGCAGTCTCCCAGGTTCTTGG + Intronic
1170410282 20:16082146-16082168 AAGGCTGTTTCTCAGGCACTGGG - Intergenic
1170680009 20:18518106-18518128 CAAACAGTTTTTCAGGCTCTTGG - Intronic
1170976266 20:21167519-21167541 CAAGCAGTTTCTCATGCTAGTGG + Intronic
1171189397 20:23148302-23148324 CCAGCAGTCTCTCATGCTGTGGG - Intergenic
1171310402 20:24140655-24140677 CATGCAGTTGATCAGGCTCAAGG + Intergenic
1172114165 20:32563807-32563829 CAGGCAATGTCCCAGGCTCTAGG - Intronic
1172235144 20:33367143-33367165 CAAGAGGTTTCTCTGGCTCTGGG + Intronic
1173168027 20:40699804-40699826 CAAGCAGATGCTGAGGCTTTGGG - Intergenic
1173538943 20:43837221-43837243 CAGGCACTGTCTCAGGCACTGGG + Intergenic
1173652508 20:44675734-44675756 CAAGCCGTTTCTCAGGCTCTTGG + Intergenic
1173763422 20:45585272-45585294 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1175602203 20:60283947-60283969 CAAGGGGTTGCTAAGGCTCTCGG + Intergenic
1175619925 20:60434884-60434906 GAAGCATTTTTGCAGGCTCTAGG - Intergenic
1175622098 20:60456491-60456513 CACTCACTTTCTTAGGCTCTGGG + Intergenic
1176686050 21:9849393-9849415 CAAGCATTTTCTTAGGCTCTTGG + Intergenic
1177103043 21:16918633-16918655 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1178001529 21:28165636-28165658 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1179314228 21:40227132-40227154 TTAGTAGTTTCTTAGGCTCTAGG + Intronic
1182595974 22:31420760-31420782 CAAGCATTATTTTAGGCTCTGGG + Intronic
1182998934 22:34838748-34838770 CAAGCATTTTTTCAGGCTTTTGG + Intergenic
1183635194 22:39057823-39057845 CAAGAAGGTTCTCAGGCTCTTGG - Intronic
949671491 3:6402111-6402133 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
950030738 3:9851450-9851472 CAAGCAGTTTCTCTGCTTCCAGG - Intronic
950073458 3:10170666-10170688 CAGGCACTGTCCCAGGCTCTGGG - Intronic
950151867 3:10693769-10693791 CAGGCAGTGTGCCAGGCTCTGGG - Intronic
951762355 3:26160907-26160929 CAAGCAGCTTCTCAGGCTCTTGG - Intergenic
951895022 3:27602122-27602144 CAAGCAATTTCTCAGGCTCTTGG + Intergenic
952297335 3:32072942-32072964 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
953599086 3:44346229-44346251 CAAGCAGTTTCTCAGGTTCTTGG - Intronic
953656088 3:44856031-44856053 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
954454912 3:50592602-50592624 CATCCAGAGTCTCAGGCTCTAGG - Intergenic
955280806 3:57592807-57592829 CAAGCATTTTCTCAGGTTATTGG - Intronic
955401180 3:58592613-58592635 CAAGCAGTTTCTTAGTCTCTTGG + Intronic
956233113 3:67039504-67039526 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
956548631 3:70435927-70435949 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
956709590 3:72027633-72027655 CAAGCATTTTTTCAGGCTCTTGG + Intergenic
957451854 3:80389852-80389874 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
957734490 3:84188679-84188701 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
957904398 3:86538727-86538749 CAAGCAGTTTCTCAGGCTCTAGG - Intergenic
957986091 3:87574160-87574182 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
958422398 3:93943115-93943137 CAAGCAGTTTCTCAGTCTCTTGG + Intronic
958676394 3:97273701-97273723 CAAGCAGTTTTTCAGGCTCTTGG - Intronic
959397378 3:105857747-105857769 CAGGCATTGTTTCAGGCTCTAGG + Intronic
959735254 3:109650689-109650711 CAAACAGTCTCTCAGACTGTGGG + Intergenic
961712313 3:128837065-128837087 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
962448192 3:135487546-135487568 CAAGCACTTTCCAAGTCTCTTGG + Intergenic
962523525 3:136218460-136218482 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
963320204 3:143802653-143802675 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
963520801 3:146358200-146358222 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
963942785 3:151111733-151111755 AAAGGAGGTTCACAGGCTCTGGG - Intronic
965070730 3:163912716-163912738 CAAGCAGTTGTTCAGGCTCTTGG + Intergenic
965262284 3:166501846-166501868 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
965335558 3:167427954-167427976 CAAGCAGTTTCTCAGACTCTTGG + Intergenic
965336693 3:167435863-167435885 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
965861559 3:173156479-173156501 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
966397215 3:179516237-179516259 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
966397983 3:179521260-179521282 CAGGCAATTTCTCTAGCTCTTGG + Intergenic
967004916 3:185375063-185375085 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
967976567 3:195038354-195038376 CAAGCATTTTCTCCTCCTCTGGG + Intergenic
968412581 4:402815-402837 AAAGCAGTTTCTCAGACTCTTGG - Intergenic
968568146 4:1325858-1325880 CCAGCAGTGGCACAGGCTCTGGG - Intronic
968645251 4:1737488-1737510 CATGCACTGTCTGAGGCTCTTGG + Intronic
969029162 4:4197468-4197490 CAGAGAGTTTTTCAGGCTCTCGG + Exonic
969202002 4:5613900-5613922 AGAGCAGTTTCTATGGCTCTTGG + Intronic
969877050 4:10143380-10143402 CTGGCAGTTTCCCAGGCTCTGGG + Intergenic
970819433 4:20195928-20195950 CAAGCAGTCTCTCAGGTCCTCGG + Intergenic
970853665 4:20631018-20631040 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
971553303 4:27980301-27980323 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
971947463 4:33299902-33299924 CCATCAGTTTCTCAGGCCTTTGG - Intergenic
973832587 4:54776558-54776580 CAGGCAGTGTATCAGGCACTGGG + Intergenic
974173071 4:58292361-58292383 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
974734844 4:65916826-65916848 ATAGCAGTTTCTAAGGCTCTTGG + Intergenic
975031078 4:69617253-69617275 CAAGCAGTTTATCAAGCTTTAGG + Intronic
975812092 4:78180124-78180146 TATACAGTGTCTCAGGCTCTGGG + Intronic
976719166 4:88153571-88153593 CAAGCAGTTTTTCGGGCTCTTGG - Intronic
977224945 4:94384191-94384213 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
978302894 4:107291575-107291597 TAAGCAGTTTCTCAGGCTCTTGG - Intergenic
979118679 4:116864378-116864400 CAAGGACTTTCACAGGCACTGGG - Intergenic
979239238 4:118433796-118433818 CAGGCACTGTGTCAGGCTCTTGG + Intergenic
980002987 4:127512228-127512250 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
980111589 4:128642143-128642165 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
980297971 4:130947354-130947376 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
980349506 4:131667867-131667889 CAAGCAGTTTCTTAGGCTCTTGG + Intergenic
980528245 4:134017109-134017131 CAAGCATTTTTTCAGGCTCATGG + Intergenic
980928124 4:139158959-139158981 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
981578308 4:146227668-146227690 GAAGCTCTTTCTCATGCTCTGGG + Intronic
981916012 4:150034068-150034090 CATGCAGTTTCTCTGACTCCTGG - Intergenic
982319266 4:154061665-154061687 CAAGCAATTTCTCAGGCTCTTGG + Intergenic
982691908 4:158557933-158557955 CTAGGAGTTTCTAAGGCACTGGG - Intronic
983056218 4:163101593-163101615 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
983345922 4:166525167-166525189 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
983530500 4:168805262-168805284 CAAGCATTTCCTAAGTCTCTAGG + Intronic
983542876 4:168931415-168931437 CAAGCTGTTTCTCAGGCCCTGGG - Intronic
983883337 4:172956886-172956908 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
984322583 4:178212066-178212088 CAAGTGCTTTCTCAGGCTCTTGG + Intergenic
984412160 4:179408350-179408372 CAAGCAGTTTCTCAGTCTTTTGG + Intergenic
984437694 4:179725626-179725648 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
985078591 4:186242878-186242900 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
985599792 5:821322-821344 CCTGCAGCTTCTTAGGCTCTGGG - Intronic
985764650 5:1770444-1770466 CAAGCAGTGTCTCAGCCCCTGGG - Intergenic
986368523 5:7058661-7058683 CGAGCAGTTTCTCAGGCTCTTGG - Intergenic
987114833 5:14718014-14718036 CAACCAGTTTCCCATGTTCTGGG - Intronic
988122053 5:26977218-26977240 CAAACAGTTTCTCAGACTAATGG + Intronic
988199531 5:28050848-28050870 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
988199546 5:28050956-28050978 CAAGCCATTTCTCAGGCTCTTGG + Intergenic
988974520 5:36501747-36501769 CAAGCAGTCACTCAGGATGTGGG + Intergenic
989177719 5:38544842-38544864 CAGGCAGTTTTTCTAGCTCTTGG - Intronic
989330688 5:40254333-40254355 CAAGCATTTTTCCAGGCTTTGGG - Intergenic
989396123 5:40958876-40958898 CAAGCCTTTTGTCAAGCTCTGGG - Intronic
990444960 5:55885889-55885911 CCAGAAGTTTCTCAGGTTCACGG - Intronic
990737475 5:58879884-58879906 CAAGCAGCATCTAAGGCTCGTGG + Intergenic
992432205 5:76720152-76720174 ATAGCAGGTTCTCAGGGTCTGGG + Intronic
992451605 5:76881190-76881212 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
992859139 5:80893910-80893932 CAAGGGGTTGCTAAGGCTCTCGG - Intergenic
994066225 5:95545621-95545643 GAAGCAGTTTCTCACCTTCTAGG - Intronic
994125695 5:96167606-96167628 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
994375369 5:99012092-99012114 CAAGCAGTTTCTTAGGCTCTTGG - Intergenic
995702261 5:114949506-114949528 CAAGAAGTTTCTCAGCCTGGTGG + Intergenic
996358292 5:122620160-122620182 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
996574629 5:124967629-124967651 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
996725367 5:126669506-126669528 CAGGCAGTCTCCCAGGCCCTGGG - Intergenic
996918053 5:128734317-128734339 CAAGCAATTTCTCAGGCTCTTGG + Intronic
997157767 5:131577217-131577239 CAAGCAGTCTCCCAGGCCTTCGG + Intronic
997678396 5:135732245-135732267 CAAGCAGTTTCTCAGGCTGTTGG - Intergenic
998097483 5:139404385-139404407 CATGCAGTTTAACAGGCCCTGGG - Intergenic
998376892 5:141696983-141697005 CAAGCTGTTTCTCTGGGTTTTGG - Intergenic
999135118 5:149313569-149313591 CAAGCAGGTGCTCAGGATCCTGG - Intronic
1000438949 5:161244945-161244967 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1000935317 5:167299202-167299224 CAAGCAGTTTTTCAGGCTCTTGG - Intronic
1001353838 5:171001738-171001760 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1001543721 5:172557146-172557168 CAAGGACATTCTCAGCCTCTTGG - Intergenic
1002077745 5:176719138-176719160 CAAGGAGTTACTCAGGGTCCAGG - Intergenic
1002633449 5:180595693-180595715 CAAGCACTTTCTCAGTGTCTCGG - Intergenic
1002739479 5:181424382-181424404 CAGGCACTGTGTCAGGCTCTTGG + Intergenic
1004768249 6:18755378-18755400 CAAGTATTTTTTCAGGCTCTTGG - Intergenic
1005786109 6:29247562-29247584 CAAGCTGTCTCTCAGGTTCTTGG - Intergenic
1006325231 6:33348638-33348660 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1006399152 6:33806083-33806105 CTATCAGCTTCTCAAGCTCTGGG + Intergenic
1007084305 6:39132487-39132509 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1007229067 6:40335614-40335636 CAGGCACTGTCTCAGGCCCTGGG - Intergenic
1007300519 6:40864620-40864642 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1008253352 6:49267685-49267707 CAAGCTGTTTTTCAGGAACTTGG + Intergenic
1009270199 6:61604945-61604967 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1009343655 6:62588493-62588515 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1009359686 6:62796179-62796201 CAAGCATTTTTTCAGGCTCTTGG + Intergenic
1009379517 6:63010158-63010180 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1009591262 6:65673685-65673707 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1009749860 6:67869391-67869413 CAAACAGTTTCTCAGACTCTTGG - Intergenic
1010586292 6:77661274-77661296 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1010735799 6:79442812-79442834 GAAGTAGTTTCCCATGCTCTTGG + Intergenic
1010840947 6:80648788-80648810 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1011026045 6:82870549-82870571 CAAAAAATTTCTCAGGCACTAGG - Intergenic
1012424795 6:99101980-99102002 CAAGCACTTTCCCAGGCACTGGG - Intergenic
1013807650 6:114012838-114012860 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1014114889 6:117660065-117660087 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1014174887 6:118321484-118321506 AGAGCAGCTTCTCAGGCACTTGG + Intergenic
1014396394 6:120929602-120929624 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1014612426 6:123561227-123561249 CAAGCAGTTTTTCAGGCTCTTGG + Intronic
1015026748 6:128542399-128542421 AAAGCAGTGTGGCAGGCTCTTGG - Intergenic
1015800963 6:137061859-137061881 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1016204883 6:141457459-141457481 GAAGCAGTTTCTCAGGCTGTAGG + Intergenic
1016751094 6:147631515-147631537 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1016781599 6:147965332-147965354 CAACCAGGTTCTGAGACTCTGGG - Intergenic
1017309546 6:152959542-152959564 CAAGCAGCGTCTGAGGCACTGGG - Intergenic
1017499387 6:155009561-155009583 CATTCAGCTTCTCAGGGTCTGGG + Intronic
1017524343 6:155229628-155229650 CAAGCACATTCTGAGGCCCTTGG + Intronic
1017922421 6:158883917-158883939 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1018078001 6:160233358-160233380 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1019091248 6:169536643-169536665 CAAGAAGTTTTCTAGGCTCTGGG + Intronic
1019244595 6:170699953-170699975 CAGGCACTGTGTCAGGCTCTTGG + Intergenic
1020322431 7:6949438-6949460 CAAGCATTTTTTCAGGCTCCTGG - Intergenic
1020540698 7:9458996-9459018 CAAGCAGTTTTTCAGGCTCCTGG - Intergenic
1021173115 7:17419071-17419093 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1021430237 7:20550428-20550450 CCAGCAGTTTTTCAGGCTCTTGG + Intergenic
1021660993 7:22917713-22917735 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1022239134 7:28491807-28491829 CATGCAGGTTCCCAGGCTGTAGG - Intronic
1022373194 7:29789265-29789287 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1023083450 7:36546880-36546902 CAAGCACTGTGCCAGGCTCTAGG - Intronic
1023925428 7:44665716-44665738 TCAGCATTTTCTCAGGCTCCAGG - Intronic
1024738824 7:52334210-52334232 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1025790610 7:64684020-64684042 CAGGCAGTTTCCCAGGCCCTTGG + Intronic
1025994804 7:66521216-66521238 CAGGCACTGTCTCAGGCACTGGG + Intergenic
1026377505 7:69766735-69766757 CGAACAATTTCTCAGGATCTGGG + Intronic
1026552246 7:71378662-71378684 CAAGCATTCTGCCAGGCTCTAGG + Intronic
1026644265 7:72154180-72154202 GAAGCAGTTTGTCTGGCCCTAGG - Intronic
1026986427 7:74557863-74557885 CAGGCACTGTCTCAGGCACTGGG + Intronic
1027158780 7:75787252-75787274 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1027354756 7:77344219-77344241 CAAGCAGTTTCTCAGGCTCTTGG + Intronic
1028287526 7:89021614-89021636 CAGGTTGTTTCTCAGGCCCTGGG + Intronic
1028589433 7:92480129-92480151 TGAGCAGTTTTTCAGGCTCTTGG - Intergenic
1029642555 7:101830166-101830188 CAACCAGTTTCCCAGGGGCTTGG - Intronic
1030163176 7:106529004-106529026 GCCTCAGTTTCTCAGGCTCTTGG - Intergenic
1030193946 7:106835032-106835054 CAAGCTGCTTCTCAGGCTCTTGG + Intergenic
1030436894 7:109533406-109533428 CAGGCAATTTCTTGGGCTCTGGG + Intergenic
1030445468 7:109643354-109643376 CAAGCAGTTTCTCAGGCTGTTGG - Intergenic
1031004989 7:116459949-116459971 CAAGCATTTTTTCAGGCTCTTGG + Intronic
1031296970 7:120013519-120013541 TAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1031354804 7:120777859-120777881 CAAACATTTTTTCAGGCTCTTGG - Intergenic
1031704228 7:124961622-124961644 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1031704239 7:124961703-124961725 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1031726743 7:125249400-125249422 CAGGCATTTTCCCAGGTTCTGGG - Intergenic
1031777773 7:125922835-125922857 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1032168065 7:129561424-129561446 CAGGCAGGTTCCCAGGCCCTGGG - Intergenic
1032514178 7:132494842-132494864 CCAGCAGTTCCCCAGGCTCAGGG + Intronic
1033471275 7:141651730-141651752 CAAGCATTTTGCCAGGCTCTGGG + Intronic
1034033144 7:147789845-147789867 TCAGCAGTTTGCCAGGCTCTCGG + Intronic
1034903569 7:154923694-154923716 CAATCACTCTGTCAGGCTCTGGG + Intergenic
1035136007 7:156703661-156703683 CAAGCATTTTCCCAGGGGCTTGG + Intronic
1035503531 8:108223-108245 CAGGCACTGTGTCAGGCTCTTGG - Intergenic
1035528956 8:336429-336451 CAATCACTTTCTGGGGCTCTGGG - Intergenic
1035880302 8:3239240-3239262 CAAGCATTTTTTCAGGCTCTTGG - Intronic
1036471934 8:9060155-9060177 CAAGCAGTTTCTCAGGCTCTTGG - Intronic
1036550102 8:9808064-9808086 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1037496427 8:19445272-19445294 CAAGCAATTTTTCTGGCACTTGG - Intronic
1040648435 8:49424726-49424748 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1041495728 8:58483365-58483387 CATGCATTTTCTCAGGCTTCTGG - Intergenic
1041651415 8:60307008-60307030 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1041917097 8:63148878-63148900 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1042024401 8:64407440-64407462 CATGCAGTTTCTCAGTGGCTTGG + Intergenic
1042706520 8:71669509-71669531 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1043599294 8:81918650-81918672 CAAGCAGTGTCTCAGGCTCTTGG + Intergenic
1045533223 8:103003622-103003644 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1045645111 8:104290365-104290387 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1046075275 8:109305380-109305402 CAAGCAGTTTCTCAGTCTCTTGG + Intronic
1046382847 8:113473371-113473393 CAAGTTGTTGCTAAGGCTCTTGG - Intergenic
1047522132 8:125603143-125603165 CAAGCGTGTTCTTAGGCTCTGGG + Intergenic
1049208950 8:141376528-141376550 CAAGCACGTTCTCAGGCTGCAGG + Intergenic
1049846084 8:144802458-144802480 CAAGCCCTTCCTCAGGCCCTAGG + Intronic
1050127038 9:2367989-2368011 AGGGCTGTTTCTCAGGCTCTGGG - Intergenic
1050140925 9:2514840-2514862 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1050869170 9:10544591-10544613 CAACCAGTATTTAAGGCTCTAGG + Intronic
1050896427 9:10889448-10889470 CAAGCAGTTTTTCAGGGTCTCGG + Intergenic
1052163502 9:25292878-25292900 CAAGCATTTTCTCAGGCTCTTGG + Intergenic
1052192218 9:25673905-25673927 CAAGCATTTTTTCAGGCTCTTGG + Intergenic
1052350524 9:27454048-27454070 AAACCAGTTTGTCAGGATCTTGG - Intronic
1052500565 9:29284369-29284391 CAAGCAGATTTTTAAGCTCTTGG + Intergenic
1053783267 9:41632205-41632227 CAAGCAGTTTCTTAGGCTCTTGG - Intergenic
1054171219 9:61842347-61842369 CAAGCAGTTTCTTAGGCTCTTGG - Intergenic
1054666313 9:67738465-67738487 CAAGCAGTTTCTTAGGCTCTTGG + Intergenic
1054820375 9:69515858-69515880 CAAGCTGTTTCTGAGGCTTACGG + Intronic
1055488144 9:76777175-76777197 CTAGCAGTTTCACATGCTTTGGG - Intronic
1055882124 9:81014005-81014027 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1056286152 9:85089790-85089812 CACACAGTTTCTCAGTCTCATGG - Intergenic
1056324288 9:85463636-85463658 CAAGCAGTTTCTCAGGCCTTTGG + Intergenic
1056363288 9:85880171-85880193 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1057068615 9:92076972-92076994 CAAGCAGTTTCCCAAGCCCTCGG + Intronic
1058025802 9:100141428-100141450 CAAGCATTTTTTCAGGCTCTTGG - Intronic
1058555215 9:106159540-106159562 CAAGCACTTCTTTAGGCTCTTGG + Intergenic
1058740125 9:107934555-107934577 CTAGCATTTTCTCAGCTTCTAGG - Intergenic
1059423428 9:114206463-114206485 CAAGCAGTTTACCTGGCTCAAGG - Intronic
1060185637 9:121562444-121562466 CAGGCAGACTCTGAGGCTCTTGG - Intergenic
1060226539 9:121794759-121794781 CAAGCAGTTCCTCAGGCTCTTGG + Intergenic
1060318100 9:122531731-122531753 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1060403268 9:123360591-123360613 GATGCAGATTCTCAGGCTCAGGG + Intronic
1060737510 9:126075691-126075713 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1061250353 9:129422847-129422869 CAAGCACTTTCTCCGGAACTGGG - Intergenic
1061778221 9:132980252-132980274 CAAGGATTTTCAAAGGCTCTGGG + Intronic
1062692426 9:137849470-137849492 CAAGCTGTTTCTCAGGCTCTTGG + Intronic
1203604785 Un_KI270748v1:49183-49205 CAGGCACTGTGTCAGGCTCTTGG + Intergenic
1185986626 X:4842253-4842275 CAAGCCATTTCTCAGCCTGTGGG + Intergenic
1186703221 X:12113709-12113731 GAAGCATATTCTCAGGTTCTGGG + Intergenic
1187907497 X:24081231-24081253 CTAGCAGTTTTTCAGTTTCTGGG - Intergenic
1188300711 X:28503645-28503667 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1188431396 X:30107985-30108007 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1188946773 X:36315035-36315057 GAAACAGATTCTCAGGCTTTAGG - Intronic
1189724321 X:43953428-43953450 AATGCAGAATCTCAGGCTCTAGG - Intronic
1191761743 X:64654327-64654349 CAAGCAGTTTCTTGGGCTCTTGG + Intergenic
1191805374 X:65130245-65130267 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1191826003 X:65365087-65365109 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1192455217 X:71270297-71270319 CAAGCAGTTTGCCAGGCTCTTGG + Intergenic
1192557199 X:72100071-72100093 CATGAAGCTTCTCAGGGTCTTGG + Intergenic
1192569039 X:72187452-72187474 CAAGCAATGTATTAGGCTCTGGG + Intronic
1192706565 X:73532732-73532754 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1192731105 X:73803478-73803500 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1192935859 X:75858083-75858105 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1193046714 X:77061703-77061725 CAAGCAGTCTCCCAGGGCCTGGG + Intergenic
1193537514 X:82732035-82732057 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1194661120 X:96629229-96629251 CAAGCGGTTTTTCAGGCTCTTGG + Intergenic
1194873374 X:99159966-99159988 CAAGCATTTTTTCAGGCTCTTGG - Intergenic
1195016667 X:100787995-100788017 CAAGCAGTTTCTCAGGCTCCTGG - Intergenic
1195290764 X:103430294-103430316 CAAGCAGTTTCTCAGGCTCCTGG - Intergenic
1195326447 X:103762392-103762414 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1195565405 X:106333952-106333974 CAAGGAGTTTATCAGGATCATGG + Intergenic
1195938558 X:110147711-110147733 CAAGAAGTCTCTCAGGATGTTGG - Intronic
1196029592 X:111082138-111082160 CAAGCAGTTGCTCAGTTACTGGG - Intronic
1196220653 X:113109997-113110019 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1196497223 X:116335557-116335579 CAAGCAGTTTTTCAGGCTCTTGG + Intergenic
1197500150 X:127231772-127231794 CAAGCAGTTTCTCAGGCTCTTGG + Intergenic
1197794668 X:130286251-130286273 CAAGGGGTTGCTAAGGCTCTTGG + Intergenic
1198966362 X:142231756-142231778 CAAGCAGTTTCTCAGGTGCTTGG + Intergenic
1199073385 X:143503804-143503826 CAAGCAGTTTCTTAGGCTCTTGG - Intergenic
1200007353 X:153096332-153096354 CAAGCAATTTCTCAGGCTCTTGG - Intergenic
1201061304 Y:10049202-10049224 CAGGCAGTCTCCCAGGCTCCTGG - Intergenic
1201307145 Y:12560813-12560835 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1201473217 Y:14355657-14355679 CAAGCAGTTTTTCAGGCTCTTGG - Intergenic
1201564240 Y:15348874-15348896 CAACCAGTTTCTCAGCTCCTGGG + Intergenic
1201581687 Y:15516808-15516830 CAAGCATGTTTTCAAGCTCTTGG + Intergenic
1201684170 Y:16682653-16682675 CAAGCATTTTCTGTGGCTTTTGG + Intergenic
1201891362 Y:18947068-18947090 CAAGCAGTTTCTCAGGCTCTTGG - Intergenic
1202062641 Y:20903815-20903837 CAAGTAGTTTCTCAGGCTCTTGG - Intergenic
1202386974 Y:24335579-24335601 CAGGCACTGTGTCAGGCTCTTGG + Intergenic
1202483812 Y:25334549-25334571 CAGGCACTGTGTCAGGCTCTTGG - Intergenic