ID: 902053395

View in Genome Browser
Species Human (GRCh38)
Location 1:13581617-13581639
Sequence TAACAGCAGCTGCTACATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902053395_902053397 6 Left 902053395 1:13581617-13581639 CCAGTATGTAGCAGCTGCTGTTA 0: 1
1: 0
2: 3
3: 15
4: 165
Right 902053397 1:13581646-13581668 CAGTAACGCATCATCATTCATGG 0: 1
1: 0
2: 0
3: 5
4: 92
902053395_902053398 12 Left 902053395 1:13581617-13581639 CCAGTATGTAGCAGCTGCTGTTA 0: 1
1: 0
2: 3
3: 15
4: 165
Right 902053398 1:13581652-13581674 CGCATCATCATTCATGGCCATGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902053395 Original CRISPR TAACAGCAGCTGCTACATAC TGG (reversed) Intergenic
902053395 1:13581617-13581639 TAACAGCAGCTGCTACATACTGG - Intergenic
903268956 1:22175961-22175983 TAACAGCAGTTCCTACATTAAGG + Intergenic
909580709 1:77230625-77230647 TAACAGCAGCTGCTCAGTGCTGG + Intergenic
910694952 1:90001879-90001901 AAGCAGCAGCTGTGACATACTGG - Intronic
911222781 1:95267001-95267023 TAACAACAGCTGCTTCATGAGGG - Intergenic
915185260 1:154099429-154099451 TGGCAGCAGCTGCTCCAGACAGG + Intronic
916888750 1:169096209-169096231 TAACAGCAGCTTCAACATCATGG - Intergenic
918197419 1:182235175-182235197 TAATAGCAGCTGCCACATATTGG - Intergenic
919289142 1:195606111-195606133 TGACATCAGCTGTTACATACAGG + Intergenic
922236007 1:223723237-223723259 TCACAGCAGCTTCTACCTCCTGG - Intronic
922783076 1:228268834-228268856 TCACAGCAGCAGCTACAAACAGG - Intronic
1063096760 10:2915490-2915512 GAACAGCCGCCGCTACATTCAGG - Intergenic
1065201592 10:23317542-23317564 TTGCAGCAGCTGCTCCAGACAGG + Exonic
1071049444 10:81428639-81428661 TATCCCCAGCTGCCACATACTGG - Intergenic
1071822586 10:89293374-89293396 TAACAGCAGCAGCCAGATCCCGG + Intronic
1076082902 10:127599702-127599724 CAACAGCAACAGCTACATAAAGG + Intergenic
1077938718 11:6817787-6817809 TTGCAGCAGCTGCTTCAGACAGG - Intergenic
1078345676 11:10545344-10545366 TTGCAGCAGCTGCTCCAGACGGG + Intergenic
1079354463 11:19718378-19718400 GAACACCAGCTGCTAAAAACAGG - Intronic
1079673896 11:23202026-23202048 TCACAGCAGCTGCTCCAGATGGG - Intergenic
1080010020 11:27449143-27449165 TTACAGCAGCTGATAAATACTGG - Intronic
1081702519 11:45161129-45161151 TAACAGCAGCACCTACATCCTGG + Intronic
1085446788 11:76606146-76606168 TAACAGCAGCGGATCCATATGGG - Intergenic
1085846092 11:80066776-80066798 TGATAGCAGCTGCTATATATGGG - Intergenic
1086039744 11:82461551-82461573 TAAGAAGAGCTGCTACATATTGG + Intergenic
1087405268 11:97722271-97722293 TACCACCAGCTGCAACATCCTGG + Intergenic
1087407996 11:97753011-97753033 TCACAGCAGCTGCTCCAGATGGG + Intergenic
1089424330 11:118359226-118359248 TAACAGAAGCTGCTTCAAAAAGG + Intergenic
1090041782 11:123298603-123298625 TTGCAGCAGCTGCTCCAGACGGG - Intergenic
1091100188 11:132864831-132864853 TAACAGCAACAACAACATACTGG + Intronic
1098987391 12:77027381-77027403 TAATAGCACCTGCTTCATATGGG - Intronic
1099406539 12:82270519-82270541 AATCAGCAGATGCTACAAACAGG + Intronic
1100306848 12:93358096-93358118 TAATAGCAGCTACTACATATTGG + Intergenic
1103586339 12:121959076-121959098 TTACAGCAGTTGCCATATACTGG - Exonic
1104361575 12:128138027-128138049 GAACAGCACCTGCTGCTTACCGG - Intergenic
1105496086 13:20932137-20932159 TAATAGCAACTGCATCATACAGG + Intergenic
1107068403 13:36242875-36242897 TCATAGCTGCTGCTACATAAGGG + Intronic
1111526766 13:89481959-89481981 TAATAGCTGAGGCTACATACAGG + Intergenic
1113116849 13:106883420-106883442 TAACAATAGCGCCTACATACAGG + Intergenic
1113777535 13:112956656-112956678 CAGCAGCAGCTGCTCCACACAGG - Intronic
1118470720 14:66072929-66072951 AAACAGCAGCTGGTTCATTCTGG + Intergenic
1118507763 14:66432969-66432991 TTACAGCAGCTTCTACATCAGGG - Intergenic
1120560199 14:85982525-85982547 TAGCAGCAGATGCTACATTACGG - Intergenic
1124517012 15:30375192-30375214 TAACAGAAGCTGCAACACGCAGG + Intronic
1124725906 15:32155525-32155547 TAACAGAAGCTGCAACACGCAGG - Intronic
1125182761 15:36896239-36896261 TAACAGCAGATGCTACAGAAAGG + Intronic
1125572744 15:40733458-40733480 TCACTGCAGCTGCTACCTCCCGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1134266720 16:12699246-12699268 TAACAGGTGCTGCTTCACACTGG + Intronic
1135377890 16:21965177-21965199 TGGCAGCAGCTTCTATATACTGG - Intronic
1135917356 16:26617000-26617022 TCACAGCACCTGCCACATGCTGG + Intergenic
1135986666 16:27189330-27189352 TCACAGCGGCTGCTCCAAACGGG - Intergenic
1138129260 16:54465641-54465663 GCACAGCACCTGATACATACTGG - Intergenic
1138314869 16:56061286-56061308 TAATAGCATCTGCCACATAGTGG - Intergenic
1139148709 16:64353437-64353459 AAACAGGATCTGCTACATTCAGG - Intergenic
1142042820 16:87906068-87906090 CATCAGCAGCTGCTACAAATGGG + Intronic
1143934771 17:10472086-10472108 TAACAACAGCTGACACATAGCGG - Intergenic
1146137800 17:30338315-30338337 CAGCAGCAGCAGCTACACACTGG - Intergenic
1147771847 17:42873386-42873408 TACCACCAGCTGGTACCTACAGG - Intergenic
1148226201 17:45899444-45899466 TAACAGCACCTGCTACATAGCGG - Intronic
1149027690 17:52048753-52048775 TGACAGCAGTAGCTACATGCTGG + Intronic
1151743316 17:75998482-75998504 TAACAGAAGCTGAGACACACAGG + Intronic
1152961821 18:84528-84550 TAACAGCAGCCACTAACTACAGG + Intergenic
1154171267 18:12053049-12053071 TAACAGCAGCTGCTAGCCATGGG - Intergenic
1154357672 18:13633952-13633974 TCACAGCAGCTGCTCCAGATGGG + Intronic
1155553947 18:26997135-26997157 TAACAGCAGATGTTACTGACAGG + Intronic
1158446973 18:57530116-57530138 GAACAGCAGCTGGTAAACACAGG + Intergenic
1159356963 18:67348959-67348981 TAACTGCAGCTTCTGCATTCTGG - Intergenic
1159916661 18:74194126-74194148 TACCAGCAGCTGCTTCCTCCAGG + Intergenic
1160180769 18:76634162-76634184 TAACACCATCTTCTACAGACAGG + Intergenic
1161005414 19:1933395-1933417 TCACAGGAGCAGCTACATTCAGG + Intergenic
1163257957 19:16169005-16169027 TAACAGGAGCTGCTAAATGCAGG - Intronic
1164788994 19:30960046-30960068 TAACAGCACTTGCCACATACAGG - Intergenic
1165060536 19:33202936-33202958 CAACTGCAGCTGGTACATCCAGG + Exonic
1166227906 19:41408416-41408438 TTACAGCAGGTGCTTCATAAGGG + Intronic
929603412 2:43219006-43219028 ACACAGCAGCAGCTACACACAGG + Intergenic
930408089 2:50987844-50987866 TTTCTGCAGCTGCTACAAACTGG - Intronic
931305353 2:61023077-61023099 TCACTGCAGCTTCTACATCCTGG + Intronic
932376465 2:71240452-71240474 CTATAGCAGCTGCCACATACAGG - Intergenic
937737667 2:125312423-125312445 TCGCAGCAGCTGCTACACATGGG - Intergenic
938083013 2:128380285-128380307 GAACAGGAGCTGCCACATCCGGG - Intergenic
939225664 2:139360856-139360878 TAACAGCAGCTTTTACAATCTGG + Intergenic
939331668 2:140771109-140771131 TAAATGCAGCTGTTTCATACTGG + Intronic
940576533 2:155512817-155512839 TCACAGCAGCTAATACTTACAGG - Intergenic
941998746 2:171626286-171626308 TCACAGCAGCTGCTCCAGACAGG - Intergenic
943223836 2:185144310-185144332 CCACAGCAGCTGCTCCAGACAGG - Intergenic
944782222 2:203030938-203030960 TCACTGCAGCTTCAACATACTGG - Intronic
945766987 2:213993158-213993180 CAGCAGCAGCTGCTACCTGCAGG - Intronic
946433588 2:219638265-219638287 TGACAGCAGCTGCCACAGGCTGG - Intronic
946759699 2:222981411-222981433 GAACAGCAGCGGCTTCTTACAGG - Intergenic
1169423831 20:5481073-5481095 GAACAGCAGGTGCAGCATACAGG - Intergenic
1172198660 20:33109877-33109899 TAATAGCAGCTGCCATTTACAGG - Intronic
1173667096 20:44770964-44770986 TAACAGCATCAGCTTCATAGGGG - Intronic
1174061056 20:47833430-47833452 TAGCAGCAGCTGCTGCATCTTGG + Intergenic
1174070719 20:47897269-47897291 TAGCAGCAGCTGCTGCATCTTGG - Intergenic
1174100379 20:48122460-48122482 TAGCAGCAGCTGCTGCATCTTGG + Intergenic
1174153344 20:48501387-48501409 TAGCAGCAGCTGCTGCATCTTGG + Intergenic
1174815322 20:53682266-53682288 TAACTGCAGCTGCGACCTCCTGG + Intergenic
1175312999 20:58024680-58024702 TGGCAGCAGCTGCTCCAGACGGG + Intergenic
1177404195 21:20645246-20645268 TGGCAGCAGCTGCTACAGATGGG - Intergenic
1179076359 21:38125850-38125872 TAACAGAACCTGGTACATAGCGG - Intronic
1181595315 22:23910748-23910770 TCACAGCAGCTGCCTCCTACTGG + Intergenic
1182255464 22:29034502-29034524 TAACAGGAGTTGCTGCAAACAGG + Intronic
951700815 3:25494877-25494899 TAACAGTAGCTGCTATTCACTGG + Intronic
954186081 3:48918201-48918223 TAACATCAGCGGCTTCATACTGG + Exonic
955337553 3:58099321-58099343 TAATAGCACCTGCAACACACAGG - Intronic
956308617 3:67854149-67854171 TGACAGCAGCTGCCTCATTCTGG + Intergenic
960709125 3:120509733-120509755 TAACAGGTGCTCCTAAATACAGG + Intergenic
961815527 3:129548236-129548258 TCATGGCAGCTGCTACATGCAGG - Intronic
962324328 3:134420859-134420881 TAACAGGAGGTGCTAGATAAAGG - Intergenic
962418901 3:135209941-135209963 TGACAGCAGATGCCACTTACAGG + Intronic
965406077 3:168270830-168270852 TAACAACAGCTACCACTTACTGG + Intergenic
965949959 3:174296931-174296953 AAACAGCAGCTGGGTCATACAGG - Intergenic
969233774 4:5850960-5850982 TCACAGCAACTGCAACATGCTGG - Intronic
972075128 4:35078655-35078677 TCACAGCAGCTGCAGCAGACAGG - Intergenic
973027048 4:45284964-45284986 TCACAGCAGCTGCTCCAGATAGG + Intergenic
973795998 4:54427406-54427428 TGACAGCAGCAGCAACAGACAGG + Intergenic
974629825 4:64473069-64473091 TAACAGAATCTGCTAAATAAAGG + Intergenic
975314509 4:72935654-72935676 GAACCTCAGCTGCCACATACGGG + Intergenic
978123250 4:105107029-105107051 GAACAGCAGCTTTTACATCCAGG + Intergenic
978149502 4:105415747-105415769 TTGCAGCAGCTGCTCCAGACGGG + Intronic
978425100 4:108573731-108573753 TACCAGAAGCTGCTATAGACTGG - Intergenic
979094221 4:116524226-116524248 TCACAGCAGCTTCTACCTCCTGG - Intergenic
980525127 4:133980314-133980336 TAACAGCAGCCTTTACATATAGG + Intergenic
981727506 4:147862547-147862569 TCACAGCGGCTGCTCCAGACTGG + Intronic
981910928 4:149981158-149981180 TAACAGCAGATGATAAATTCTGG - Intergenic
984691646 4:182732950-182732972 TAACAGCGCCTGCTACAGAACGG - Intronic
986748296 5:10762467-10762489 TAACAGCAGTTGCAAAACACTGG - Intergenic
986803617 5:11286684-11286706 TAACAGGAGTTGGCACATACAGG + Intronic
988024296 5:25665460-25665482 AAACAGCAGCTGCTACCTCAAGG + Intergenic
989392171 5:40912451-40912473 TCACTGCAGCTGCTACATCCTGG + Intronic
992999168 5:82363241-82363263 TTACAGCAGTTGCTTCACACTGG - Intronic
993845004 5:92930610-92930632 TAACAGGAGCTCCTAAAAACAGG - Intergenic
997258496 5:132447393-132447415 TAACAACAGCGGCCACGTACAGG + Intronic
999214237 5:149918468-149918490 TAACAGCAGCTGCTTCACAGGGG + Intronic
1000267777 5:159654712-159654734 TAACAGCATCTGACACTTACTGG + Intergenic
1000507889 5:162144578-162144600 TTACAGCAACTTCTACATGCAGG - Intronic
1000768602 5:165322182-165322204 GAACATGAGCTGCTACATGCGGG - Intergenic
1002678159 5:180935804-180935826 TCACAGCAACTGCTCCAGACAGG + Intronic
1006820429 6:36889198-36889220 CAACAGCAGCTGCTGCAGAGAGG + Intronic
1009588507 6:65637382-65637404 TTGCAGCAGCTGCTCCACACTGG - Intronic
1011042786 6:83049244-83049266 TAATAACAGCTTCTACAGACTGG + Intronic
1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG + Intronic
1014044566 6:116870224-116870246 AAACAGCAGCTGGGACATAGTGG - Intergenic
1014398346 6:120954579-120954601 TAACAACACCTGCCACATAGGGG - Intergenic
1014505466 6:122248625-122248647 TCACAGCAGCTGATCCAGACAGG + Intergenic
1015660905 6:135572306-135572328 TAGAAGCAGCTGCTCCATAGAGG + Intergenic
1019923762 7:4179363-4179385 TAGCAGGAGCTGCTGCATAGTGG + Intronic
1025026213 7:55518399-55518421 AAACATCAGGTGCTACACACTGG + Intronic
1025153208 7:56577034-56577056 TATCAGGTGCTGATACATACGGG - Intergenic
1025233684 7:57219508-57219530 TAGCAGCAGCTGCTGCACCCTGG - Intergenic
1028634639 7:92973429-92973451 TGAAAGCAGCTGCTTCATTCAGG + Intergenic
1032418539 7:131758470-131758492 TAACAGCTCCTGGCACATACTGG + Intergenic
1032919388 7:136528073-136528095 TTACAGCAGCTGCTCCAGATGGG + Intergenic
1035953115 8:4045526-4045548 TAACAGCATCTGCTGCCCACAGG - Intronic
1036791805 8:11726077-11726099 TACCATCACCTGGTACATACAGG + Intronic
1042866526 8:73361521-73361543 TAACTGCAGCTTCTGCATCCTGG + Intergenic
1045782725 8:105886677-105886699 TGGCAGCAGCTGCTCCAGACGGG - Intergenic
1046775311 8:118158342-118158364 TTGCAGCAGCTGCTCCAGACAGG - Intergenic
1046783154 8:118237344-118237366 TAACAGCAGCTGATACATAGAGG - Intronic
1047318483 8:123755650-123755672 TCACAGCTGCTGCTCCAGACAGG + Intergenic
1048174918 8:132142932-132142954 TAACAACATCTGCTTCATAGAGG + Intronic
1048557025 8:135489060-135489082 TAACAGCTGCTGCCATTTACTGG - Intronic
1049832133 8:144707858-144707880 AAACACCAACTGATACATACTGG + Intergenic
1050126354 9:2360161-2360183 TAACAGCAGATGCTGAATAATGG + Intergenic
1050474779 9:6029380-6029402 TAACAGCAGCTTATAAATATAGG - Intergenic
1057530339 9:95839466-95839488 GACCAGCAGCTGCTTCACACAGG - Intergenic
1058077544 9:100666813-100666835 TTGCAGCAGCTGCTCCAGACTGG - Intergenic
1059484211 9:114614492-114614514 AAACAGCAGCAGCTACAGAATGG - Intronic
1060852103 9:126886610-126886632 TAACAGCAGCCGTTACTCACGGG - Intergenic
1060878932 9:127104241-127104263 CAACAGCAGCTGCCACAGACGGG - Intronic
1186655717 X:11609699-11609721 CAACAGCATCTGCTACATTCAGG + Intronic
1189681204 X:43518545-43518567 TTTCAGCAGCTGCTCCATATGGG - Intergenic
1190047736 X:47126178-47126200 CAACAGCAGCTCCTAAACACAGG - Intergenic
1191603140 X:63032415-63032437 TACCACCAGCAGCTACATGCTGG - Intergenic
1191791827 X:64979222-64979244 TAGCAGCAGCAGCTTGATACAGG - Intronic
1194206678 X:91019029-91019051 TCACAGCAGCTCCTAAATTCTGG - Intergenic
1194891602 X:99385268-99385290 CCACAGCAGCTGCTACAGATGGG + Intergenic
1195043785 X:101037844-101037866 TAACATCAGCTGATATTTACTGG - Intronic
1196268047 X:113676206-113676228 CCACAGTAGCTGCTACATTCAGG - Intergenic
1198189347 X:134287487-134287509 TTGCAGCAGCTGCTCCAGACAGG - Intergenic
1200398560 X:156005681-156005703 TAACAGCAGCCACTAACTACAGG - Intronic
1200552425 Y:4593818-4593840 TCACAGCAGCTCCTAAATTCTGG - Intergenic
1201391455 Y:13502010-13502032 AGACAGCAGCTGCAGCATACAGG - Intergenic