ID: 902054717

View in Genome Browser
Species Human (GRCh38)
Location 1:13590748-13590770
Sequence CTGTAGGCAGAAATAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902054713_902054717 8 Left 902054713 1:13590717-13590739 CCGTGCTGAGTGGAAGAGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 205
Right 902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG 0: 1
1: 0
2: 3
3: 42
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902054717 Original CRISPR CTGTAGGCAGAAATAGAGAA TGG Intronic
900835635 1:5001602-5001624 CTGTAAGCCGTAAGAGAGAAGGG + Intergenic
900878972 1:5366901-5366923 TTGAAGGCAGAAAGAGTGAAAGG + Intergenic
901823220 1:11843681-11843703 CTGAAGGGAGAAACAGACAACGG - Intergenic
901907703 1:12428596-12428618 CTCTGGCCAGAAACAGAGAAGGG - Intronic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG + Intergenic
903194621 1:21675985-21676007 CTGTAGGCAGAAATACTGGCTGG - Intergenic
903552072 1:24164541-24164563 CTGGAGCCAAAAGTAGAGAAGGG - Intronic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
905114514 1:35625820-35625842 CTGTAAGGAGAATTTGAGAAAGG + Intronic
906155687 1:43612687-43612709 CTGTAAGCAGAAAAAGTTAACGG + Intronic
907281964 1:53354178-53354200 CTGTTGGCAGGAATAGAAAATGG - Intergenic
907322895 1:53616862-53616884 ATGTGGCCAGAAATAGGGAAAGG + Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
907665980 1:56434272-56434294 GTGTAGGAAGAAAGAAAGAATGG - Intergenic
908549067 1:65191319-65191341 CTTTAGGCAGAAATCCAGAATGG - Intronic
910565643 1:88639772-88639794 GTGCAGGCTGAAAGAGAGAAAGG + Intergenic
910765804 1:90781061-90781083 CTGTATGAAGAAACAGAGACTGG + Intergenic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
911241981 1:95477303-95477325 CAGCAGGCAAAAAGAGAGAATGG - Intergenic
911628460 1:100154998-100155020 CTGTAGCCAGAAAGAAAGCAAGG + Intronic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
913429703 1:118777066-118777088 CTGTAGGCAGCAGTAGGGAGGGG + Intergenic
914848827 1:151298915-151298937 CTGTAGGAAGTAATCGAGCAAGG + Exonic
915321777 1:155060486-155060508 CTGTGGGCACATATAGGGAAGGG - Intronic
915444004 1:155964479-155964501 CTGAAGACAGAGATAAAGAAGGG + Intronic
915936969 1:160095316-160095338 TTGTAGGCAGAGATCAAGAATGG - Intronic
916656497 1:166880887-166880909 CTGTTGGCAGAAATGCAAAATGG - Intergenic
918907917 1:190523596-190523618 ATATAGGCAGAAATCAAGAATGG - Intergenic
918957207 1:191223717-191223739 AAATAGGCAGAAAGAGAGAAAGG + Intergenic
919018854 1:192077281-192077303 TTGCAGGCAGAAAGAGAGAAGGG - Intergenic
919019433 1:192084967-192084989 CTGTAGGAAGAAATTGCTAAGGG + Intergenic
919957489 1:202433455-202433477 CTGTAGGCAAAGATAGAGTGAGG - Intronic
919963639 1:202498607-202498629 CTGTAGGCCCATATAGATAATGG - Intronic
920066167 1:203271477-203271499 CTGGAGGCAGGAACAGAGAAGGG - Intronic
920169263 1:204060327-204060349 CAGAAGGGAGAAAGAGAGAATGG + Intergenic
920505020 1:206509233-206509255 CTGCAGGCAGAAAAAGGGTAGGG - Intronic
920587590 1:207182556-207182578 CTGAAACCAGAAATAGTGAATGG + Intergenic
920910928 1:210215670-210215692 CAGAAGGAAGAAATAGAGTAGGG + Intergenic
921263127 1:213401291-213401313 CTGAAGGCTGAGATAGAGAGGGG + Intergenic
921808342 1:219481042-219481064 CTGTAGCCTGGAATGGAGAATGG - Intergenic
922665463 1:227465127-227465149 CAGCAGGCAGAAACAAAGAATGG + Intergenic
923813271 1:237344376-237344398 TTGGAGCCAGAAATAAAGAAAGG - Intronic
923826888 1:237510141-237510163 CTGGAGGCAGGAAGAGAGACAGG + Intronic
923860336 1:237886500-237886522 ATGTAGGCTGAAATGTAGAATGG + Intronic
924603233 1:245509848-245509870 CTGAAGGCAGGAAGGGAGAAGGG - Intronic
1062778768 10:181187-181209 CTATGGGTAGAAATGGAGAATGG + Intronic
1062928399 10:1335424-1335446 ATGGAGGGAGAAATAGAGGAAGG + Intronic
1062997623 10:1881753-1881775 CTGGAGGGAGCAACAGAGAAGGG + Intergenic
1063236277 10:4119871-4119893 CTTTAGACAGAAAAAGAGATAGG - Intergenic
1063268472 10:4480061-4480083 CTGTAGGCATAAAGAGAAACTGG + Intergenic
1063781355 10:9328757-9328779 CTGTAAGCAGAAATAAACATAGG - Intergenic
1065047378 10:21756756-21756778 CTGTAGGAAGAAAAAAAGAGAGG + Intronic
1066976177 10:42369702-42369724 CTATGGGCATAAATACAGAAGGG + Intergenic
1066995398 10:42558456-42558478 CAGTATGCAAAAATAGAGAAAGG - Intergenic
1067243746 10:44518359-44518381 CTGAATGCAGAAATAGACGATGG - Intergenic
1068061267 10:52070735-52070757 TTGAAGGAAGAAGTAGAGAATGG - Intronic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1068492539 10:57742091-57742113 GTGTATGCAGAGATAGGGAAAGG - Intergenic
1069179476 10:65340065-65340087 ATATAGACAGGAATAGAGAAAGG - Intergenic
1071322559 10:84478147-84478169 TTTTAGGCAGAACTAGGGAATGG + Intronic
1072027696 10:91477515-91477537 CTGTAAGCAGAGGAAGAGAAAGG + Intronic
1072098613 10:92207394-92207416 CTGGAGACAGAAAGACAGAATGG + Intronic
1074254186 10:111783910-111783932 TTGTAGGCAGTCATTGAGAAGGG + Intergenic
1074471012 10:113726762-113726784 CTGTGGTCAGAAAGAGAGCACGG - Intronic
1074653149 10:115547966-115547988 CTGGAGGCGGGATTAGAGAATGG + Intronic
1074716923 10:116228389-116228411 CCATAGCCAGAAATAGAGAGTGG - Intronic
1075006924 10:118837743-118837765 CAGGAGGAAGAAAGAGAGAAGGG + Intergenic
1075447806 10:122526012-122526034 CTGGAGGAAGGAATAGAGAGAGG + Intergenic
1075560503 10:123464766-123464788 CAATGGGCAGAAATAGAGAAAGG - Intergenic
1077613448 11:3659340-3659362 CTGGAGGGAGAAAGAGAGAGAGG + Intronic
1077644062 11:3908007-3908029 CTGTAATGAAAAATAGAGAAAGG - Intronic
1078229481 11:9426585-9426607 CTGCTGGCAGAAATATAAAATGG - Intronic
1079998219 11:27319078-27319100 ATGGAGGCAGGAAAAGAGAAAGG + Intergenic
1080050881 11:27857772-27857794 CAGGAGCCAGAGATAGAGAATGG - Intergenic
1080353979 11:31419961-31419983 GAGAAGGCAGCAATAGAGAATGG - Intronic
1081223495 11:40491900-40491922 TGGTAGGCAGAATTATAGAATGG - Intronic
1082895795 11:58188625-58188647 CATTTGGCAGAAGTAGAGAATGG - Intergenic
1083381964 11:62276518-62276540 CAGGAGGCAGGAGTAGAGAAGGG - Intergenic
1083533541 11:63447622-63447644 CTGTTGGAAGAAAAAGAGCAAGG + Intergenic
1084403174 11:68956449-68956471 CTTTAAGCAGACATAGAGGAGGG - Intergenic
1086148428 11:83580940-83580962 ATGTAGGGAGGAATGGAGAAAGG - Intronic
1086861940 11:91934577-91934599 CAGGAGGCAGAAGCAGAGAAGGG - Intergenic
1087034455 11:93741940-93741962 CTGAAGGCAGAAATAGACAAAGG - Exonic
1087144824 11:94800878-94800900 CTGTAGGAAGAATTAGGGCAAGG - Intronic
1087521310 11:99240315-99240337 CAGTAGGAAAAAGTAGAGAACGG + Intronic
1088907113 11:114163218-114163240 CTTGAGGCAGAAAGCGAGAAGGG - Intronic
1090284936 11:125491662-125491684 TTGTAGGTAGAGATGGAGAATGG - Intronic
1090837501 11:130463998-130464020 CTGTAGGCAGAAACAGAGCAAGG + Intronic
1091874765 12:3924716-3924738 CTGTCTGCACAAATAGAGACTGG + Intergenic
1092720085 12:11432872-11432894 GTGTATACAGAAAGAGAGAAGGG - Intronic
1093106504 12:15094020-15094042 CTCTAGAGAGAAATGGAGAAGGG + Intergenic
1093334168 12:17880270-17880292 CTGTTGGTAGAAATGGAAAATGG + Intergenic
1094234610 12:28149205-28149227 CTGGAAGCAGAAATAGTTAAAGG + Intronic
1094327341 12:29255265-29255287 CTCTAGGCAGACACAGAGAAAGG - Intronic
1094392182 12:29963659-29963681 TTGTGGGGAGGAATAGAGAAAGG + Intergenic
1095218015 12:39572777-39572799 CTGCAGCCAGAAAGAGAGAGAGG + Intronic
1096290251 12:50336208-50336230 CAGTAGGGAGAGAGAGAGAAAGG - Intronic
1096293469 12:50362438-50362460 CTATAGACAAAAATAAAGAAAGG + Intronic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1097802877 12:63934375-63934397 ATGGAGGCAGAAAGAGAGATGGG - Intronic
1098127138 12:67309371-67309393 CTGAAGACAGAAATAAAGTAGGG + Intronic
1098304544 12:69089640-69089662 CTCTAAGGAGAACTAGAGAAGGG - Intergenic
1098317374 12:69206942-69206964 TTCTAGGCAGCAATAGATAATGG + Intergenic
1098450943 12:70617556-70617578 CTGTAGCCAGAACTAAAGATGGG - Intronic
1099387668 12:82036138-82036160 CTGGAAGCAGAAAGAGATAATGG - Intergenic
1100035285 12:90243315-90243337 CTGTAGTAAGCAATAGAGGAAGG - Intergenic
1101107868 12:101457659-101457681 CTCTAGGCAAGAATAGAGATTGG - Intergenic
1101311771 12:103587114-103587136 CAGTAGGCAGGACTAGAGGAGGG + Intergenic
1101405779 12:104427500-104427522 CCGTAGGAAGAAATGGGGAAAGG - Intergenic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1102041425 12:109803302-109803324 CTGGAGGCAGAAAGATAGAGTGG - Intronic
1103598614 12:122039869-122039891 CTGTATTCAAAAATAGAGACAGG + Intronic
1103815492 12:123651893-123651915 CTGAAGGCAGAAAGACATAATGG - Intronic
1105603598 13:21909036-21909058 ATGTAGGCAGAAATACAAATGGG + Intergenic
1105744991 13:23369350-23369372 CTGTAGGAAGAACAAGAAAATGG + Intronic
1105745384 13:23373194-23373216 ATGTCGGCAGGCATAGAGAAAGG + Intronic
1107605998 13:42057806-42057828 CTATAGAGAGAAATAGAGCATGG + Intronic
1107803823 13:44135334-44135356 GTGAAGGCAGAAACAGAGACTGG + Intergenic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108743758 13:53367765-53367787 CTGTAGGCAGGAAGGAAGAAAGG + Intergenic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1109215218 13:59582392-59582414 CTGTGGGCAGAAAAGGAGTAAGG - Intergenic
1109380816 13:61557665-61557687 CGGGAGGCAGAGACAGAGAATGG + Intergenic
1110077756 13:71270254-71270276 CTCTAGGAAGTATTAGAGAAAGG - Intergenic
1110522562 13:76498102-76498124 ATGTGTGCAGAAATAGAGGAAGG + Intergenic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1113192405 13:107764457-107764479 ATGTAGACAGAGAGAGAGAAAGG + Intronic
1114008293 14:18337858-18337880 TTGAAGGCAGAGAAAGAGAATGG + Intergenic
1114397596 14:22380906-22380928 CTCCAGGCTGAACTAGAGAAGGG - Intergenic
1114679895 14:24475517-24475539 CTGTGGGCTGCAATAGAGGAAGG - Intergenic
1116441430 14:44958854-44958876 CTGAAGACAGAAATACATAATGG + Intronic
1117840849 14:59859334-59859356 CAGTAGGCAAAAAGAGAGATTGG - Intronic
1118105081 14:62649606-62649628 ATGTAGGCAGACATGGAAAAGGG + Intergenic
1118590769 14:67399244-67399266 CAGGTGGCAGGAATAGAGAAGGG + Intronic
1118590813 14:67399488-67399510 CAGGTGGCAGGAATAGAGAAGGG + Intronic
1119203228 14:72774402-72774424 CTGTTGGTAGAAATGGAAAATGG - Intronic
1120430569 14:84409304-84409326 CTTTAGGCAGAAATAATAAATGG + Intergenic
1121258365 14:92548641-92548663 GTGAAGGCAGAGGTAGAGAATGG - Intronic
1121558382 14:94855735-94855757 CTGTAGGCAGAGGGACAGAATGG - Intergenic
1121786923 14:96668929-96668951 CTGTAGGTAGAAATTCACAAAGG - Intergenic
1124634970 15:31359587-31359609 ATGAAGGCAGAAATGCAGAAAGG + Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125288048 15:38115369-38115391 CTTGAGGCAAAAAAAGAGAAAGG + Intergenic
1125425235 15:39542101-39542123 CTGTAGGCAGAGATATAAAATGG + Intergenic
1126127081 15:45304846-45304868 CTTAAGGGAGAAAGAGAGAAAGG + Intergenic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1127012701 15:54647465-54647487 CTGTAGGAAGAGACAAAGAAAGG + Intergenic
1127022539 15:54764785-54764807 CTGTAGGAAGAGACAAAGAAGGG + Intergenic
1128500411 15:68223308-68223330 CTGGAGCCAGAGAAAGAGAAGGG + Intronic
1128611932 15:69081030-69081052 TTGCAGGAAGAAATAGAGCAAGG - Intergenic
1129601572 15:77001850-77001872 CTGTTGGGAGAATGAGAGAAAGG + Intronic
1130080551 15:80729173-80729195 CAGGAACCAGAAATAGAGAAAGG - Intronic
1131317568 15:91353495-91353517 CTGAAGGCAAAAAGAGAGAGTGG - Intergenic
1131397471 15:92097994-92098016 CTGTAGGCATTAATAGGCAAGGG + Intronic
1131436469 15:92426552-92426574 CTGGAAGCAGGAAAAGAGAAAGG + Intronic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1134309829 16:13065681-13065703 CTGTAGGAAAGAACAGAGAAAGG + Intronic
1137600076 16:49750444-49750466 CAGTTGGCAGAAAGAGAGGAAGG - Intronic
1137857321 16:51807765-51807787 CAGAAGCCAGAAATAGAAAAGGG - Intergenic
1138149288 16:54641064-54641086 CAGGAGGAAGAAACAGAGAAAGG - Intergenic
1138902307 16:61287594-61287616 ATGTAGGCAGAAGTAGAGGTGGG - Intergenic
1139085501 16:63580339-63580361 ATGTAGGCAGGATTATAGAATGG - Intergenic
1139246224 16:65446975-65446997 GTGTAGGCAGAGAGAGGGAAAGG + Intergenic
1140162946 16:72517933-72517955 ATGTAGGCAGAACTACAAAAAGG - Intergenic
1141306849 16:82872751-82872773 CTGGAGATAGAAATAGGGAATGG + Intronic
1141760559 16:86026092-86026114 GGGTAGGCAGAGACAGAGAAGGG + Intergenic
1142861081 17:2762091-2762113 CGGGAGGCTGAGATAGAGAATGG - Intergenic
1142920987 17:3185876-3185898 CTTTAAGCAGAAATAGAAAATGG - Intergenic
1143730005 17:8876060-8876082 CTGTTGGCAGATGAAGAGAAAGG - Intergenic
1143998769 17:11032968-11032990 CTGTTGGTGGAAATACAGAATGG + Intergenic
1145187939 17:20811976-20811998 TTGGAGGAAGAAAGAGAGAAAGG + Intergenic
1145963146 17:28898893-28898915 CTGTAGGCAGGAAGAAAGAAAGG + Intronic
1146667267 17:34713448-34713470 CTGTGGGCAGATGTAGAGGAGGG - Intergenic
1146971683 17:37077982-37078004 CTGTTGGCAGGAATAGAAAATGG - Intergenic
1147131898 17:38414792-38414814 CTGTAGGGAAAAAGAGAGGAGGG + Intergenic
1148664347 17:49362923-49362945 CTGTGGCCAGGAATAGGGAAGGG + Intergenic
1150435197 17:65148514-65148536 CTGTTGGTAGAAATATAAAATGG - Intronic
1151040313 17:70851922-70851944 CTGTAGTCAGAAAAGGGGAAAGG + Intergenic
1151520324 17:74624036-74624058 AAGTAGGCAGCCATAGAGAAGGG - Intergenic
1153347363 18:4041940-4041962 CTGTGGGCAGAGATATGGAATGG + Intronic
1154089820 18:11346862-11346884 CCCAAGGCAGAAAAAGAGAAAGG + Intergenic
1155512500 18:26592473-26592495 CTGTGGGGAGAACTAGAGATTGG - Intronic
1156391655 18:36656197-36656219 ACAAAGGCAGAAATAGAGAAGGG - Intronic
1156634764 18:39013872-39013894 CTCTAGGCATAAATAGAAAAAGG - Intergenic
1157598898 18:48880724-48880746 CTGTAGCCAGAAGTAGAAATTGG - Intergenic
1158268317 18:55684326-55684348 CTGTTGGGAGAAACAAAGAAAGG - Intergenic
1158313201 18:56181475-56181497 CTGTAGGAAGAAATGGAAAAAGG + Intergenic
1159782126 18:72672365-72672387 CTGGAAGCAGAGAAAGAGAAGGG + Intergenic
1160291293 18:77596466-77596488 CTGTAAGAAGGAAGAGAGAATGG + Intergenic
1164087119 19:21913018-21913040 CTTAAGGCAGAAAGAGAGACTGG + Intergenic
1164500712 19:28817657-28817679 CTGAAGGTAGACATAGAGGAGGG - Intergenic
1167311145 19:48738783-48738805 CTCTAGGCAGAGCTAGAGCAGGG - Intronic
1167539110 19:50074186-50074208 CTCCAGGCAGAAAGAGAGGAAGG + Intergenic
1167939961 19:52938597-52938619 CTGAAGGAGGAAATAGGGAAAGG + Intronic
1168074783 19:53974554-53974576 CTGTTGGTAGAAATATAAAATGG - Intronic
1168133083 19:54333272-54333294 CAGTAGTTAGAAATAAAGAAAGG + Exonic
925601674 2:5614216-5614238 CTGTTGGGAGAAATAGGGGAGGG + Intergenic
926439114 2:12869385-12869407 CTGAAGGCAGCCATAGACAAGGG - Intergenic
927248981 2:20981342-20981364 GTGTAGCCAGAAACAGAGGAGGG - Intergenic
927288508 2:21381467-21381489 CTGTCGGTAGAAATATAAAATGG + Intergenic
927580119 2:24235902-24235924 CTGCTGGCGGAAATAGAAAATGG + Intronic
929115111 2:38437471-38437493 CTGTAGGAAGAAGCAGAGACTGG - Intergenic
929401853 2:41592135-41592157 TTGTAAGCAGAAATAGTTAAAGG + Intergenic
930510645 2:52340148-52340170 ATGTTGGAAGAAATAGAGAAAGG - Intergenic
930587065 2:53279581-53279603 CTGTGGGCAGAAATGTAGAGTGG + Intergenic
930599577 2:53427680-53427702 CTGTAGGCAGAATGTGAGATTGG - Intergenic
930963602 2:57291581-57291603 ATTTAGGCAGACAGAGAGAAAGG - Intergenic
931292295 2:60883308-60883330 CTGTAGGCAGAAAAGGAAATTGG + Intronic
931375292 2:61701826-61701848 CTCTAGGCAGAAATGTACAATGG - Intergenic
932029330 2:68167227-68167249 CTGGAGGCTGAATTAGAGAGTGG + Intronic
932862836 2:75312308-75312330 GTGTTGGGAGAAATAGACAAAGG - Intergenic
933322666 2:80796594-80796616 CAGTAGATAGAAAGAGAGAAGGG - Intergenic
933565609 2:83946847-83946869 ATGTAGGCAGTGAGAGAGAAAGG - Intergenic
933939499 2:87233619-87233641 CAGGAGGGAGCAATAGAGAAAGG - Intergenic
934582821 2:95459255-95459277 CTATAGGCAGAAAGAGGCAACGG - Intergenic
934596629 2:95617459-95617481 CTATAGGCAGAAAGAGGCAACGG + Intergenic
936353636 2:111732154-111732176 CAGGAGGGAGCAATAGAGAAAGG + Intergenic
936979966 2:118255269-118255291 CTGAAGGCAGAATTAAACAAAGG + Intergenic
938316764 2:130334974-130334996 CAGAAGCCAGAAATAGAGATGGG + Intergenic
938873468 2:135507337-135507359 CTATAGGGAGAGATAGAGAATGG + Intronic
939588803 2:144037761-144037783 ATGCAGGCAGAAAAAGAAAACGG + Intronic
939753957 2:146086041-146086063 CAGGAGCCAAAAATAGAGAAGGG - Intergenic
939929867 2:148219888-148219910 CTGTTAGCAGAATCAGAGAATGG + Intronic
940564123 2:155338841-155338863 CTGCAAGCAGAAATAGTGAAAGG + Intergenic
940656298 2:156491619-156491641 CTGTAGGCAAAAATTTACAATGG - Intronic
941254055 2:163205715-163205737 CTATAGACAGAGAGAGAGAATGG - Intergenic
943291648 2:186079547-186079569 CAGGAGGAAGAAAGAGAGAATGG + Intergenic
943312350 2:186342333-186342355 CTTTAGGCAGAAAGAGAAGAGGG + Intergenic
943933818 2:193888622-193888644 CTGTAAGCAGAAAAAAAGGAAGG + Intergenic
944556837 2:200895660-200895682 CTCTAGGAAGTAATTGAGAAAGG + Intronic
945040851 2:205742806-205742828 CTGTAAGCACAAATAGTTAATGG + Intronic
945067528 2:205959808-205959830 CTGGAGGCAAAAATAGAGAGTGG + Intergenic
945404806 2:209432294-209432316 CTGTAGGCAGAGAAACAGGAAGG - Intronic
945919669 2:215742942-215742964 GTATAGGCAAAAGTAGAGAAGGG - Intergenic
946169492 2:217886172-217886194 GTGAAGGGAGAAAGAGAGAAAGG + Intronic
946843916 2:223842585-223842607 TTGTTGGCAGAAATAGAGTAAGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168939848 20:1699907-1699929 CTGAAAGCAGCAATAGAGAATGG + Intergenic
1169997732 20:11577273-11577295 CAGGAGGAAGAAATAGACAAGGG - Intergenic
1170438207 20:16351654-16351676 CTGGTGGCAGAGATAGAGATGGG - Intronic
1170501923 20:16982803-16982825 CTATAGAAAGAAACAGAGAAAGG - Intergenic
1171354419 20:24533343-24533365 CTGTGGTCAGAACTGGAGAAGGG - Intronic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1173129796 20:40380751-40380773 ATGTAAGCAAAAATAAAGAAGGG - Intergenic
1173325950 20:42033875-42033897 CTATAGTCAGCAACAGAGAAAGG - Intergenic
1173556004 20:43966368-43966390 TTGTAGCCAGAAATAAAGAAGGG + Intronic
1175037553 20:56014687-56014709 CTGTAGGGAGAAAAATAGGAAGG - Intergenic
1175777555 20:61662841-61662863 CTGTAGGCGGACATGGAGATAGG - Intronic
1176937762 21:14886205-14886227 CAGTAGGCAAAAATAGACACAGG + Intergenic
1179272313 21:39861018-39861040 CTATAGACAGAAATAAAGCAAGG - Intergenic
1179318766 21:40270215-40270237 CTGGAGGCAGAAGCAGAGAATGG - Intronic
1180198807 21:46212815-46212837 CTGCAGACAGACATCGAGAACGG + Intronic
1180432798 22:15268675-15268697 TTGAAGGCAGAGAAAGAGAATGG + Intergenic
1180750154 22:18119006-18119028 CTGTAGGCAGGACTAGAGGGTGG + Intronic
1180784024 22:18536975-18536997 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1181127592 22:20711023-20711045 CAGCAGGCAGAGAAAGAGAAGGG + Intronic
1181240924 22:21476327-21476349 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1182657984 22:31904952-31904974 ATGTAGGCAGAACTAAAGAAGGG - Intronic
1182797208 22:32999739-32999761 CTGGAGGCAGAACTAGAGGGAGG + Intronic
1183172726 22:36199678-36199700 CTATACGCAGAAATAGAGATGGG + Intronic
1183180506 22:36256991-36257013 CTATACACAGAAATAGAGATGGG - Intronic
1183485382 22:38085376-38085398 CTGTAGGAGGAGAGAGAGAATGG + Intronic
1184344909 22:43907357-43907379 CTGTAGGAAGAAAGAGGGGAGGG - Intergenic
949412546 3:3781745-3781767 CTGTAGGGTGGAATAGAAAAAGG - Intronic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
951409790 3:22348661-22348683 CTGTAGAAAGAAAGAAAGAAAGG + Intronic
951578727 3:24139685-24139707 CTCAAGTCAGAAATAGAGACAGG - Intronic
952271959 3:31841701-31841723 GTGCAGGCATAACTAGAGAAAGG - Intronic
952734561 3:36675954-36675976 CTGTAGGAAGAAAAAGAAAAGGG + Intergenic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
957484927 3:80848086-80848108 ATGAAGACAGAAAGAGAGAAAGG - Intergenic
958592919 3:96182268-96182290 CAGTAGACAGAAGGAGAGAAAGG - Intergenic
959104202 3:102047837-102047859 GTGTAGGCAGAAAAAAAAAATGG - Intergenic
959800783 3:110493231-110493253 CTGAAGGCAGAAACAGACTAGGG + Intergenic
959864682 3:111252793-111252815 CTTGAGGAAGAAAGAGAGAAAGG + Intronic
960249813 3:115439398-115439420 CTGGAAGCAGAACTAGAGAGAGG - Intergenic
961555133 3:127691970-127691992 CTTTATGCAAAAAAAGAGAAAGG - Exonic
963270169 3:143278590-143278612 GTGAAGACAGAAATAGAGATTGG - Intronic
963291082 3:143490062-143490084 CTGTTGGTAGAAATATAAAATGG + Intronic
963811528 3:149781596-149781618 CTGATGGAAGAAATAGAGGAAGG - Intronic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
964763906 3:160159960-160159982 CTGTAGGCAGAAGCTGAGGATGG - Intergenic
965674788 3:171183228-171183250 CAGCAGGGAGCAATAGAGAACGG - Intronic
966069895 3:175862989-175863011 CTGTTAGCAGCAATACAGAAAGG + Intergenic
966284815 3:178282572-178282594 CTGTTGGTAGAAATACAAAATGG + Intergenic
966624554 3:182002028-182002050 CTTTTAGCAGAAACAGAGAAAGG - Intergenic
966889404 3:184395685-184395707 CTTTAGGGAGAAAAAAAGAACGG + Intronic
967478941 3:189952598-189952620 GTGGAGGTAGAAATAGGGAATGG - Intergenic
967553921 3:190832169-190832191 CTGCATGCAGAAACAGAGTAAGG + Intergenic
967805482 3:193711416-193711438 CTGGAGGCAGAAAGAGGGCAGGG + Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968268517 3:197381307-197381329 CTTTTGGCAGAGATAGTGAATGG - Intergenic
971155436 4:24076527-24076549 ATGTGGGAAGAACTAGAGAAAGG + Intergenic
971169901 4:24223149-24223171 CTATAGGCACAAAGACAGAAGGG + Intergenic
971195862 4:24471507-24471529 CTGGAGCGAGAAATAGAGAGAGG - Intergenic
971685984 4:29768878-29768900 CTGCTGGAAGAAAGAGAGAATGG - Intergenic
972639243 4:40910787-40910809 CTGAAGGCACAAATAGGGAGTGG - Intronic
972689459 4:41382465-41382487 CTGTAGGCAGCAGTAGGGAGGGG + Intronic
973627177 4:52784500-52784522 ATGTAGGCAGAAAACTAGAAGGG - Intergenic
973745173 4:53956957-53956979 CTGAAGGCAGGTATAGAAAAGGG - Intronic
974095480 4:57359317-57359339 CTGTTAAGAGAAATAGAGAATGG + Intergenic
974458472 4:62159169-62159191 CTGTTGTGAGAAATAGAAAATGG + Intergenic
975619398 4:76280870-76280892 CAGGAGGCAGAAATGAAGAAAGG - Intronic
976368351 4:84257416-84257438 CTTTAGACAGAGATAGAAAAGGG + Intergenic
976462089 4:85323564-85323586 GTGGAGGCAGAAAGAGTGAAGGG + Intergenic
976492846 4:85692235-85692257 TTAAAGGCAGATATAGAGAAGGG - Intronic
976505281 4:85838884-85838906 CTGGAGGAAGAAATAAAGAGAGG - Intronic
977098206 4:92772389-92772411 CTGCAGGAAGAAAGAGAGTAGGG - Intronic
977197183 4:94077779-94077801 CACTAGGCAGAAATATGGAATGG - Intergenic
977210948 4:94217028-94217050 CTGTTGGCAGAAATGTAAAATGG - Intronic
977765814 4:100796472-100796494 CTGTCAGCAGAAGTAGAGATGGG - Intronic
978823346 4:112991475-112991497 CAGAAGCCAGGAATAGAGAAGGG - Intronic
979772712 4:124548861-124548883 CTTTAGGCAGTGATAGATAATGG - Intergenic
980654947 4:135769538-135769560 CTGAGGGCAGAAAGAGAGATTGG + Intergenic
981215103 4:142155701-142155723 CTGTAGGCATCATTAGAGAAAGG + Intronic
981490308 4:145332318-145332340 CTGTTGGTAGAAATATAAAATGG - Intergenic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
982782041 4:159501313-159501335 AGGTAGGCAGGAAGAGAGAAAGG - Intergenic
982983622 4:162175234-162175256 CTGTTGGCAGAAATGTAAAATGG + Intergenic
983541374 4:168914601-168914623 TGGTAGGCAGAGATAGAGAAAGG + Intronic
984179072 4:176458728-176458750 CAGAAGGCAGAAATAGAGAGGGG + Intergenic
984685434 4:182662497-182662519 CTGGAGGAAAAAATAGAGACAGG - Intronic
985202912 4:187503003-187503025 CTGCAGCCAGAAAGAGAAAAAGG - Intergenic
987777346 5:22385235-22385257 CTGTATGTAGAAATAAAAAAAGG - Intronic
988622038 5:32832992-32833014 ATGCAGACAGAAATAGAGACAGG + Intergenic
988973720 5:36494681-36494703 CTATAGCAAGAAAGAGAGAATGG - Intergenic
989225743 5:39026032-39026054 GAGTAGGAAGAAATAGAGACAGG - Intronic
990487918 5:56277510-56277532 CTGTGGGAAGAAATAGAGTGGGG - Intergenic
990754046 5:59048380-59048402 CTGTATGCAGTAATTGACAAAGG - Intronic
991411276 5:66347875-66347897 CTGAAGCCTGCAATAGAGAAAGG + Intergenic
994046297 5:95314180-95314202 CTGTTGTCAGTGATAGAGAAGGG - Intergenic
994210282 5:97080208-97080230 CATTTGGCAGAAATAGAGATGGG + Intergenic
994377570 5:99032492-99032514 CTGTTGGAAGCAATAGGGAAAGG + Intergenic
994933855 5:106225787-106225809 CTGTAGGCAGAAAGAAGAAATGG - Intergenic
994971924 5:106750164-106750186 CTGAAGGCAGCCAGAGAGAAAGG + Intergenic
995138677 5:108708006-108708028 CTGTGGGCAGGAACATAGAAAGG - Intergenic
996012257 5:118493985-118494007 CTGTAGGCAGAGCTGGACAATGG - Intergenic
997021417 5:130007395-130007417 CTGAAGGAAGTAATAGAGAATGG + Intronic
997229515 5:132232421-132232443 CTGTAGGCAGACAGCGAGACAGG - Intronic
998323352 5:141254350-141254372 CTGCAGTCAGAAACATAGAAAGG - Intergenic
1003035620 6:2638364-2638386 GTGTAGACAGAAAAAGAGCAAGG - Intergenic
1004121009 6:12822229-12822251 ATGTTGGCAGAAATAGAAACTGG + Intronic
1006440182 6:34049081-34049103 TTGTAAGCAGGAACAGAGAAAGG - Intronic
1007918264 6:45582783-45582805 CTGTAGTTAGAAATAGGGAGGGG + Intronic
1008201629 6:48598199-48598221 CGGGAGCCAGAAATAGAGGAGGG - Intergenic
1008766052 6:54916223-54916245 CTGCAGGCAGAAAGAGAAAGAGG - Intronic
1009738526 6:67711909-67711931 CTGAAAGCATAAATAAAGAAAGG - Intergenic
1009785718 6:68336759-68336781 GTGGAGGGAAAAATAGAGAAAGG - Intergenic
1009837882 6:69027801-69027823 CAGTAGGTAGAAATAGAGTGTGG + Intronic
1010175036 6:73018090-73018112 TGTTATGCAGAAATAGAGAAGGG + Intronic
1010424778 6:75716352-75716374 CTTTAAGCTGTAATAGAGAAAGG - Exonic
1010835157 6:80577594-80577616 CTGAAGGCAAAAATAGAGATTGG - Intergenic
1010930906 6:81801787-81801809 CTGTAGGCTCATATAGCGAAAGG - Intergenic
1011000732 6:82585176-82585198 CTGAAGACAAAAATAGAGAAAGG + Intergenic
1011000759 6:82585519-82585541 CTGGAGGAAGAAGTAGAGAAAGG - Intergenic
1011041939 6:83039302-83039324 GTGTAGGCTGAAGTAAAGAAGGG + Intronic
1011951665 6:92974394-92974416 CTGAAGGCAGAATCAGAGGATGG - Intergenic
1012288754 6:97424618-97424640 GTGTAGGCTGAGAGAGAGAAAGG + Intergenic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1014748931 6:125233005-125233027 CTGTAGGCAGAAGTAGAATCAGG + Intronic
1015662487 6:135590831-135590853 CTGGAGCAAGCAATAGAGAATGG + Intergenic
1016097960 6:140061298-140061320 TGGTATGCAGAAATTGAGAAAGG + Intergenic
1016187823 6:141220321-141220343 CTGCAGACAGAAAGAGAAAAAGG + Intergenic
1016510815 6:144840877-144840899 CCGCATGCAGAAAAAGAGAAAGG - Intronic
1016547968 6:145245552-145245574 CTGTCTGCAGACACAGAGAAAGG - Intergenic
1016713069 6:147195534-147195556 CTATAGGAAGAAAAAGAAAAGGG - Intergenic
1017067143 6:150539583-150539605 CTGAAGGCAGAAATTGGAAAGGG - Intergenic
1017606354 6:156138593-156138615 CTGTTGGCAGAAATGTAAAATGG - Intergenic
1017633292 6:156420397-156420419 CTGTGGGCAGAACTAAAGAAAGG + Intergenic
1017785177 6:157751005-157751027 CTGTTGGCAGGAATACAAAATGG + Intronic
1018327443 6:162687495-162687517 TTTTATGGAGAAATAGAGAATGG + Intronic
1018556478 6:165056329-165056351 AAGTAGATAGAAATAGAGAAAGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021355922 7:19653161-19653183 CTAAAGGCAGCTATAGAGAAGGG + Intergenic
1023223033 7:37940115-37940137 CTGTAGGCATTAGTGGAGAATGG + Intronic
1024378373 7:48665092-48665114 CTGTAGGGAGACAAACAGAAGGG + Intergenic
1024850005 7:53701870-53701892 AAGTAGACAGAAATATAGAAGGG - Intergenic
1025012429 7:55408230-55408252 AAGCAGGCAGAAATAGACAATGG + Intronic
1025119295 7:56286690-56286712 CTGTTGGCAGAAATGTAAAATGG + Intergenic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1025620528 7:63166142-63166164 TTGTATGCAGAAAAAGAGCAAGG + Intergenic
1025936221 7:66039828-66039850 CAGGAGGAAGAAATAGAGAGAGG - Intergenic
1026611658 7:71865306-71865328 CTGGAGGAAGAGATAGAGAGGGG - Intronic
1027303617 7:76868317-76868339 CTGTAAGTGGCAATAGAGAAGGG - Intergenic
1028069938 7:86439239-86439261 CTATAGGAAGAAAGAAAGAAAGG - Intergenic
1028522348 7:91746430-91746452 CTGATGGAGGAAATAGAGAATGG - Intronic
1030461919 7:109849361-109849383 ATGAAGGCAGAAGTAGAGATTGG - Intergenic
1032694893 7:134326661-134326683 CTGTTGGTAGAAATATAAAATGG - Intergenic
1033769452 7:144533284-144533306 CTGTTGGCAGGAATAGAAAATGG + Intronic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1037385328 8:18333819-18333841 CTGTAGGACGAGAGAGAGAATGG + Intergenic
1039237108 8:35513595-35513617 CTGTAGGGAAAAATAAAGCAGGG - Intronic
1041270953 8:56108324-56108346 ATGTAGACAGATATACAGAAAGG - Intergenic
1041682655 8:60608808-60608830 CTGTAGACTAGAATAGAGAAGGG - Intronic
1042329617 8:67564664-67564686 CTTTAGGCAGAAATAGTGGCTGG - Intronic
1042725749 8:71874814-71874836 CAGAAGGAAGAAAGAGAGAAGGG - Intronic
1043005970 8:74819204-74819226 CTGAAAGCAGAAATATAGATGGG - Intronic
1043269574 8:78314740-78314762 CCTTAGGAAGAAATAGAGATTGG + Intergenic
1044174145 8:89096348-89096370 CTTTAGACAGAGATAGAAAAGGG - Intergenic
1044356968 8:91233902-91233924 GTGAAGGCAGTAAAAGAGAATGG - Intronic
1044579964 8:93814999-93815021 TTGTATAAAGAAATAGAGAAAGG + Intronic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1044741602 8:95332809-95332831 CTGGAGGGAGGAATAGAGGAGGG + Intergenic
1045281010 8:100749781-100749803 GTGTAGGAAGTAAAAGAGAAAGG + Intergenic
1046316511 8:112509834-112509856 CTGTAGGAGGAGATAGGGAAAGG - Intronic
1046545933 8:115649973-115649995 CTAAATGCAGAAATAGAGGAAGG - Intronic
1046591504 8:116212745-116212767 CTGTAGGCAGCAATAGGTCATGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047246244 8:123147516-123147538 ATCTACGTAGAAATAGAGAAAGG + Intronic
1047805493 8:128355312-128355334 GTGGAGGGAGAAATAGACAAAGG - Intergenic
1048288871 8:133164415-133164437 CAGAAGGCAGAAATACAGAATGG - Intergenic
1048711350 8:137214955-137214977 CAGTAGGGAGACAGAGAGAATGG + Intergenic
1052651845 9:31313787-31313809 ATGTATGCAGAAATACAGAATGG - Intergenic
1052764531 9:32627216-32627238 TTGAAGGCAGAGAAAGAGAAAGG - Intergenic
1055593732 9:77844555-77844577 CTGTAGGAAGAAATTAAAAATGG + Intronic
1055857876 9:80713472-80713494 CTATAAGCAGAAAAAGAGCACGG - Intergenic
1055882708 9:81020780-81020802 ATACAGTCAGAAATAGAGAAGGG + Intergenic
1056069169 9:82968038-82968060 CAGTAGGTAGAAATTGAGATTGG - Intergenic
1056425348 9:86470010-86470032 CTGTGGCCATAAAAAGAGAAGGG - Intergenic
1057446722 9:95121256-95121278 CAGTAGGCAGAAATTGAAATGGG - Intronic
1058792778 9:108467982-108468004 CTAAAGGCAGAAATAGAGAAGGG - Intergenic
1059649322 9:116300610-116300632 CTGTTGGCAGAAATAAACAAGGG + Intronic
1061141674 9:128771432-128771454 CTGGCGGCAGGGATAGAGAAAGG + Intronic
1187599897 X:20817100-20817122 CTGTTGTCATAAAAAGAGAAAGG + Intergenic
1187647662 X:21366637-21366659 CTGTATCCAGAAAGAGAGAGAGG - Intergenic
1187992780 X:24893946-24893968 CTGAAGGCAGAGACAGAAAAAGG - Intronic
1188067878 X:25683686-25683708 CTGTAGGCAGCTATAAAAAATGG - Intergenic
1188209229 X:27399331-27399353 AAGTAGGTACAAATAGAGAAAGG + Intergenic
1188801471 X:34536300-34536322 CTGTAGTAAGAAACAGAAAATGG + Intergenic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1188897011 X:35681219-35681241 AATTAGTCAGAAATAGAGAATGG + Intergenic
1189270269 X:39746578-39746600 CTGTAGGTGGAAATGGTGAAAGG + Intergenic
1192616282 X:72626159-72626181 ATGTAGGGAGGAAGAGAGAAAGG + Intronic
1192961595 X:76137251-76137273 CTGTGGGAAGGAATAGAAAAAGG - Intergenic
1192986843 X:76408851-76408873 CTGTAGGCCTAAATAAAAAAGGG - Intergenic
1193062240 X:77219582-77219604 ATGGAGTCAGAAATGGAGAATGG + Intergenic
1193099625 X:77594047-77594069 CTCTAGATAGAAAAAGAGAAAGG + Intronic
1193613885 X:83665376-83665398 CTAAAGGCAGAAAGAGAAAATGG - Intergenic
1193989955 X:88294562-88294584 CTGTAGCATGAAATAAAGAAGGG + Intergenic
1194314715 X:92362235-92362257 CTGTTGGTAGAAATATAAAATGG - Intronic
1196291038 X:113941434-113941456 CTGTTGGCAGGAATACAAAATGG + Intergenic
1196380816 X:115087155-115087177 CAGTAGGGATAAGTAGAGAAGGG - Intergenic
1196861650 X:120034242-120034264 CTGAAGGCAGGAATAGAGATGGG + Intergenic
1197353783 X:125409205-125409227 AAGAAGGCAGAAATGGAGAAAGG - Intergenic
1198999815 X:142621825-142621847 CTAAAGGCAAAAAAAGAGAAGGG + Intergenic
1200622771 Y:5473752-5473774 CTGTTGGTAGAAATATAAAATGG - Intronic
1200785583 Y:7257645-7257667 CTGTTGAGAGAAAGAGAGAAAGG - Intergenic
1201073329 Y:10169449-10169471 CTGAAGGAGGAAGTAGAGAAAGG - Intergenic
1201587586 Y:15577882-15577904 CTGTAGGCAGAGAAAAAGAGAGG - Intergenic
1201938961 Y:19437956-19437978 ATGAAGGCAGAAATAAAGATAGG + Intergenic