ID: 902060533

View in Genome Browser
Species Human (GRCh38)
Location 1:13638357-13638379
Sequence AACCATATCAAGCATCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902060527_902060533 30 Left 902060527 1:13638304-13638326 CCAACAGTGAAGATTACAATTCA No data
Right 902060533 1:13638357-13638379 AACCATATCAAGCATCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902060533 Original CRISPR AACCATATCAAGCATCTACC AGG Intergenic
No off target data available for this crispr