ID: 902063155

View in Genome Browser
Species Human (GRCh38)
Location 1:13662226-13662248
Sequence CCATACAGAAATCGGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063155_902063161 17 Left 902063155 1:13662226-13662248 CCTCACTGCCGATTTCTGTATGG No data
Right 902063161 1:13662266-13662288 CTATAAATTTGTTCTGACCAGGG No data
902063155_902063164 28 Left 902063155 1:13662226-13662248 CCTCACTGCCGATTTCTGTATGG No data
Right 902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG No data
902063155_902063160 16 Left 902063155 1:13662226-13662248 CCTCACTGCCGATTTCTGTATGG No data
Right 902063160 1:13662265-13662287 TCTATAAATTTGTTCTGACCAGG 0: 5
1: 4
2: 4
3: 9
4: 149
902063155_902063163 19 Left 902063155 1:13662226-13662248 CCTCACTGCCGATTTCTGTATGG No data
Right 902063163 1:13662268-13662290 ATAAATTTGTTCTGACCAGGGGG 0: 6
1: 86
2: 151
3: 103
4: 169
902063155_902063162 18 Left 902063155 1:13662226-13662248 CCTCACTGCCGATTTCTGTATGG No data
Right 902063162 1:13662267-13662289 TATAAATTTGTTCTGACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902063155 Original CRISPR CCATACAGAAATCGGCAGTG AGG (reversed) Intergenic
No off target data available for this crispr