ID: 902063157

View in Genome Browser
Species Human (GRCh38)
Location 1:13662234-13662256
Sequence GGGAAGTGCCATACAGAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063157_902063162 10 Left 902063157 1:13662234-13662256 CCGATTTCTGTATGGCACTTCCC No data
Right 902063162 1:13662267-13662289 TATAAATTTGTTCTGACCAGGGG No data
902063157_902063164 20 Left 902063157 1:13662234-13662256 CCGATTTCTGTATGGCACTTCCC No data
Right 902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG No data
902063157_902063161 9 Left 902063157 1:13662234-13662256 CCGATTTCTGTATGGCACTTCCC No data
Right 902063161 1:13662266-13662288 CTATAAATTTGTTCTGACCAGGG No data
902063157_902063163 11 Left 902063157 1:13662234-13662256 CCGATTTCTGTATGGCACTTCCC No data
Right 902063163 1:13662268-13662290 ATAAATTTGTTCTGACCAGGGGG 0: 6
1: 86
2: 151
3: 103
4: 169
902063157_902063160 8 Left 902063157 1:13662234-13662256 CCGATTTCTGTATGGCACTTCCC No data
Right 902063160 1:13662265-13662287 TCTATAAATTTGTTCTGACCAGG 0: 5
1: 4
2: 4
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902063157 Original CRISPR GGGAAGTGCCATACAGAAAT CGG (reversed) Intergenic
No off target data available for this crispr