ID: 902063158

View in Genome Browser
Species Human (GRCh38)
Location 1:13662254-13662276
Sequence CAAATTTATAGACAAAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063158_902063170 30 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063170 1:13662307-13662329 CTAAATCTGCTGTGATTCTGGGG 0: 7
1: 168
2: 295
3: 166
4: 260
902063158_902063169 29 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063169 1:13662306-13662328 TCTAAATCTGCTGTGATTCTGGG 0: 7
1: 163
2: 299
3: 166
4: 457
902063158_902063162 -10 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063162 1:13662267-13662289 TATAAATTTGTTCTGACCAGGGG No data
902063158_902063164 0 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG No data
902063158_902063168 28 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063168 1:13662305-13662327 CTCTAAATCTGCTGTGATTCTGG 0: 8
1: 164
2: 319
3: 164
4: 266
902063158_902063163 -9 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063163 1:13662268-13662290 ATAAATTTGTTCTGACCAGGGGG 0: 6
1: 86
2: 151
3: 103
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902063158 Original CRISPR CAAATTTATAGACAAAGAAA GGG (reversed) Intergenic
No off target data available for this crispr