ID: 902063159

View in Genome Browser
Species Human (GRCh38)
Location 1:13662255-13662277
Sequence ACAAATTTATAGACAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063159_902063170 29 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063170 1:13662307-13662329 CTAAATCTGCTGTGATTCTGGGG 0: 7
1: 168
2: 295
3: 166
4: 260
902063159_902063164 -1 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG No data
902063159_902063168 27 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063168 1:13662305-13662327 CTCTAAATCTGCTGTGATTCTGG 0: 8
1: 164
2: 319
3: 164
4: 266
902063159_902063169 28 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063169 1:13662306-13662328 TCTAAATCTGCTGTGATTCTGGG 0: 7
1: 163
2: 299
3: 166
4: 457
902063159_902063163 -10 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063163 1:13662268-13662290 ATAAATTTGTTCTGACCAGGGGG 0: 6
1: 86
2: 151
3: 103
4: 169
902063159_902063171 30 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063171 1:13662308-13662330 TAAATCTGCTGTGATTCTGGGGG 0: 9
1: 258
2: 245
3: 113
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902063159 Original CRISPR ACAAATTTATAGACAAAGAA AGG (reversed) Intergenic
No off target data available for this crispr