ID: 902063162

View in Genome Browser
Species Human (GRCh38)
Location 1:13662267-13662289
Sequence TATAAATTTGTTCTGACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063157_902063162 10 Left 902063157 1:13662234-13662256 CCGATTTCTGTATGGCACTTCCC No data
Right 902063162 1:13662267-13662289 TATAAATTTGTTCTGACCAGGGG No data
902063155_902063162 18 Left 902063155 1:13662226-13662248 CCTCACTGCCGATTTCTGTATGG No data
Right 902063162 1:13662267-13662289 TATAAATTTGTTCTGACCAGGGG No data
902063158_902063162 -10 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063162 1:13662267-13662289 TATAAATTTGTTCTGACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902063162 Original CRISPR TATAAATTTGTTCTGACCAG GGG Intergenic