ID: 902063164

View in Genome Browser
Species Human (GRCh38)
Location 1:13662277-13662299
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063158_902063164 0 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG No data
902063157_902063164 20 Left 902063157 1:13662234-13662256 CCGATTTCTGTATGGCACTTCCC No data
Right 902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG No data
902063155_902063164 28 Left 902063155 1:13662226-13662248 CCTCACTGCCGATTTCTGTATGG No data
Right 902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG No data
902063159_902063164 -1 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type