ID: 902063168

View in Genome Browser
Species Human (GRCh38)
Location 1:13662305-13662327
Sequence CTCTAAATCTGCTGTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063165_902063168 -1 Left 902063165 1:13662283-13662305 CCAGGGGGCATCCCTGGAGTTTC No data
Right 902063168 1:13662305-13662327 CTCTAAATCTGCTGTGATTCTGG No data
902063158_902063168 28 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063168 1:13662305-13662327 CTCTAAATCTGCTGTGATTCTGG No data
902063159_902063168 27 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063168 1:13662305-13662327 CTCTAAATCTGCTGTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902063168 Original CRISPR CTCTAAATCTGCTGTGATTC TGG Intergenic