ID: 902063170

View in Genome Browser
Species Human (GRCh38)
Location 1:13662307-13662329
Sequence CTAAATCTGCTGTGATTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063166_902063170 -10 Left 902063166 1:13662294-13662316 CCCTGGAGTTTCTCTAAATCTGC No data
Right 902063170 1:13662307-13662329 CTAAATCTGCTGTGATTCTGGGG No data
902063165_902063170 1 Left 902063165 1:13662283-13662305 CCAGGGGGCATCCCTGGAGTTTC No data
Right 902063170 1:13662307-13662329 CTAAATCTGCTGTGATTCTGGGG No data
902063159_902063170 29 Left 902063159 1:13662255-13662277 CCTTTCTTTGTCTATAAATTTGT No data
Right 902063170 1:13662307-13662329 CTAAATCTGCTGTGATTCTGGGG No data
902063158_902063170 30 Left 902063158 1:13662254-13662276 CCCTTTCTTTGTCTATAAATTTG No data
Right 902063170 1:13662307-13662329 CTAAATCTGCTGTGATTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902063170 Original CRISPR CTAAATCTGCTGTGATTCTG GGG Intergenic