ID: 902063689

View in Genome Browser
Species Human (GRCh38)
Location 1:13666300-13666322
Sequence CCCATTCCTGCTCTTCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902063689_902063697 11 Left 902063689 1:13666300-13666322 CCATAATGAAGAGCAGGAATGGG No data
Right 902063697 1:13666334-13666356 AAGGGCATCGCTTCACCATGTGG No data
902063689_902063698 22 Left 902063689 1:13666300-13666322 CCATAATGAAGAGCAGGAATGGG No data
Right 902063698 1:13666345-13666367 TTCACCATGTGGACACCAACAGG No data
902063689_902063695 -8 Left 902063689 1:13666300-13666322 CCATAATGAAGAGCAGGAATGGG No data
Right 902063695 1:13666315-13666337 GGAATGGGGGTGGGCGTGCAAGG No data
902063689_902063696 -7 Left 902063689 1:13666300-13666322 CCATAATGAAGAGCAGGAATGGG No data
Right 902063696 1:13666316-13666338 GAATGGGGGTGGGCGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902063689 Original CRISPR CCCATTCCTGCTCTTCATTA TGG (reversed) Intergenic
No off target data available for this crispr