ID: 902064922

View in Genome Browser
Species Human (GRCh38)
Location 1:13677075-13677097
Sequence GTGTCGGAGGTAGAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902064922_902064930 6 Left 902064922 1:13677075-13677097 CCCACCAGCTCTACCTCCGACAC No data
Right 902064930 1:13677104-13677126 TTACATTTCAACATGAGATTTGG 0: 567
1: 2965
2: 7294
3: 14959
4: 13729
902064922_902064933 11 Left 902064922 1:13677075-13677097 CCCACCAGCTCTACCTCCGACAC No data
Right 902064933 1:13677109-13677131 TTTCAACATGAGATTTGGAGGGG 0: 846
1: 1596
2: 2653
3: 5160
4: 15694
902064922_902064931 9 Left 902064922 1:13677075-13677097 CCCACCAGCTCTACCTCCGACAC No data
Right 902064931 1:13677107-13677129 CATTTCAACATGAGATTTGGAGG 0: 787
1: 1530
2: 2251
3: 2703
4: 2761
902064922_902064932 10 Left 902064922 1:13677075-13677097 CCCACCAGCTCTACCTCCGACAC No data
Right 902064932 1:13677108-13677130 ATTTCAACATGAGATTTGGAGGG 0: 950
1: 2046
2: 4640
3: 14272
4: 15373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902064922 Original CRISPR GTGTCGGAGGTAGAGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr