ID: 902067127

View in Genome Browser
Species Human (GRCh38)
Location 1:13697969-13697991
Sequence CCCTGCTGCCACCTTAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2686
Summary {0: 1, 1: 19, 2: 165, 3: 696, 4: 1805}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902067123_902067127 -8 Left 902067123 1:13697954-13697976 CCAGAGGGAGCCCGGCCCTGCTG 0: 2
1: 4
2: 40
3: 132
4: 550
Right 902067127 1:13697969-13697991 CCCTGCTGCCACCTTAATTTTGG 0: 1
1: 19
2: 165
3: 696
4: 1805

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902067127 Original CRISPR CCCTGCTGCCACCTTAATTT TGG Intergenic
Too many off-targets to display for this crispr