ID: 902067465

View in Genome Browser
Species Human (GRCh38)
Location 1:13700206-13700228
Sequence GATGGCGGCGGCGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 420}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902067458_902067465 3 Left 902067458 1:13700180-13700202 CCGACGTCACTTCCGACTGGAGT 0: 1
1: 0
2: 0
3: 4
4: 35
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420
902067461_902067465 -9 Left 902067461 1:13700192-13700214 CCGACTGGAGTCAAGATGGCGGC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420
902067457_902067465 4 Left 902067457 1:13700179-13700201 CCCGACGTCACTTCCGACTGGAG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420
902067454_902067465 12 Left 902067454 1:13700171-13700193 CCTCGCCGCCCGACGTCACTTCC 0: 1
1: 0
2: 0
3: 9
4: 65
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420
902067450_902067465 27 Left 902067450 1:13700156-13700178 CCCCGCAGGCCACTGCCTCGCCG 0: 1
1: 0
2: 1
3: 7
4: 159
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420
902067455_902067465 7 Left 902067455 1:13700176-13700198 CCGCCCGACGTCACTTCCGACTG 0: 1
1: 0
2: 1
3: 0
4: 24
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420
902067452_902067465 25 Left 902067452 1:13700158-13700180 CCGCAGGCCACTGCCTCGCCGCC 0: 1
1: 0
2: 1
3: 33
4: 314
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420
902067451_902067465 26 Left 902067451 1:13700157-13700179 CCCGCAGGCCACTGCCTCGCCGC 0: 1
1: 0
2: 0
3: 10
4: 247
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420
902067453_902067465 18 Left 902067453 1:13700165-13700187 CCACTGCCTCGCCGCCCGACGTC 0: 1
1: 0
2: 1
3: 38
4: 286
Right 902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG 0: 1
1: 0
2: 6
3: 58
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902067465 Original CRISPR GATGGCGGCGGCGCGGCCGC GGG Intronic
900171992 1:1273794-1273816 GGCGGCGGCGGCGCTGCGGCGGG - Exonic
900243990 1:1629395-1629417 GCGGGCGGGGGCGCGGCCCCGGG + Exonic
900255059 1:1693524-1693546 GCTGGCGTCGGGGCTGCCGCGGG + Intronic
900263802 1:1746790-1746812 GCTGGCGTCGGGGCTGCCGCGGG + Intergenic
900269146 1:1778346-1778368 GCTGGCGGCGGCGCGGCGGCGGG - Intronic
900393542 1:2443985-2444007 GTTGGCAGCGGCGCAGCGGCAGG - Intronic
900786928 1:4655225-4655247 AACGGCGGCGGCGCGCCGGCCGG + Exonic
901022141 1:6260932-6260954 GCTGGCGGCGGAGCGGCCCGCGG + Exonic
901242726 1:7704508-7704530 GACGGCGGGGGCCCGGCCGGAGG - Intronic
901381637 1:8878481-8878503 GAGGGAGGCGGCGCGCCCGCAGG - Intronic
902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG + Intronic
903446147 1:23424160-23424182 GATGGCGGGGGCGGGGCGGGGGG - Intronic
904055614 1:27668255-27668277 AATGGGGGCGGCGTGCCCGCCGG - Exonic
904215400 1:28914781-28914803 GGCGGCGGCGGCGCGGGAGCCGG + Intronic
904500150 1:30908584-30908606 CATGGCGGCGGCGCGGGCGCGGG + Exonic
905546494 1:38804289-38804311 GCTGCCGGCGGCGCAGCCGAGGG - Intergenic
905862645 1:41361513-41361535 GGCGGCGGCGGCGCGGGCTCCGG + Intergenic
907136294 1:52142313-52142335 GAGGGCACCGGCGCGGCCCCAGG - Exonic
907429936 1:54405913-54405935 AGTGGCGGCCGCGCCGCCGCCGG - Intronic
909170012 1:72282875-72282897 GAGGGAGGAGGCGCGGCGGCGGG + Intergenic
910387808 1:86704492-86704514 GATTGCGGCGGCGCAGCCCCGGG - Intergenic
910935097 1:92480848-92480870 GCTGCCGGCGGCGCGGGGGCCGG - Exonic
910981180 1:92961348-92961370 GCTGGTGGCTGGGCGGCCGCCGG + Intronic
911078961 1:93909336-93909358 GACGGCGGCTGGGCGGCGGCGGG + Exonic
912411355 1:109482853-109482875 GATGGCGGCGGGGGGGGGGCGGG + Intergenic
912481563 1:109985299-109985321 GGTGGCGGCTGTGCGGCCCCAGG + Intronic
912915638 1:113812052-113812074 GTTGGCGGCTGCGACGCCGCCGG + Exonic
914125467 1:144813800-144813822 GACGGCGGCGGAGAGGCGGCCGG - Intergenic
914869045 1:151458590-151458612 GGCGGCGGCGGAGCGGCCCCTGG - Intronic
914937551 1:151993861-151993883 GAGGGAGGCGGCGCGGGAGCGGG + Exonic
915358792 1:155273246-155273268 GATGGCGGCGACACTGCGGCCGG + Exonic
916091923 1:161314335-161314357 GAGGGCGGAGGCGCGCCGGCTGG - Exonic
917291615 1:173477259-173477281 GGCGGCGGGGGCGGGGCCGCGGG - Exonic
917869601 1:179229647-179229669 GATGGCGGCGGCGGTGGCGGCGG - Intronic
918652558 1:186983748-186983770 GATGGCGGCGGGGCGGGGGTGGG + Intronic
919463190 1:197902701-197902723 GCTGGCGGCGGGGCGGCGGAAGG - Exonic
919892101 1:201982930-201982952 GACGGCGGCGGCGCTGCGGCGGG + Exonic
920021272 1:202958252-202958274 GATCGGGGCCGCTCGGCCGCAGG - Exonic
920556636 1:206909358-206909380 GATCGCGGCGGCGGCGGCGCGGG + Intronic
922730517 1:227946844-227946866 GAGGGCGGCGGCCCGGCTGAGGG + Intronic
923369424 1:233295569-233295591 GACGGCGGGGGCGCGGCCCGCGG - Exonic
924741956 1:246799445-246799467 GATGGGGGCGGCACGGATGCTGG - Intergenic
1062774792 10:135767-135789 GAGGGCGGCGGCGGGGCCTGCGG + Intronic
1062843779 10:689671-689693 GGAGGCGGCGGCGCGGGCGCGGG + Intronic
1063664100 10:8051507-8051529 GATGCCGCCGCCGCCGCCGCAGG - Intergenic
1064443067 10:15370929-15370951 GTGGGCGGCGGCGGGGCCGGGGG - Intronic
1064553050 10:16521405-16521427 GCCGGCGCCGGCGCGGCCACCGG + Exonic
1065099100 10:22316304-22316326 GCTGGCGGCGGCGCGGGCTGCGG - Exonic
1065099531 10:22320630-22320652 GAAGAGGCCGGCGCGGCCGCGGG + Intronic
1069024071 10:63521421-63521443 GAGGGCGCCAGCGCGGCCCCGGG + Exonic
1070032617 10:72692200-72692222 GGCGGCGGCGGCGGGGGCGCCGG + Exonic
1072102207 10:92239824-92239846 GCCGGCTGCGGCGCGGGCGCAGG + Exonic
1072710824 10:97714571-97714593 GGCGGCGGCGGCGCTGCCGTCGG - Exonic
1073043275 10:100621587-100621609 CGGGGCGGCGGGGCGGCCGCCGG + Intergenic
1073147952 10:101292610-101292632 GCGGGCGCGGGCGCGGCCGCGGG - Intergenic
1073156894 10:101354338-101354360 GCTGGCGGCGGAGCGGCTGGAGG + Intronic
1074503342 10:114044973-114044995 CCGGGCGGCGGCGCGGGCGCGGG - Exonic
1075334487 10:121598451-121598473 GGCGGCGGCGGCGCGGGCGGCGG - Intronic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076282532 10:129260694-129260716 GGTGGAGGCGGCGCTGCCTCCGG - Intergenic
1076554243 10:131311652-131311674 GACGGCGGCGGCGGGGGCGGCGG + Exonic
1076900652 10:133335915-133335937 GATGGCGGGGGCGGGGGTGCAGG + Intronic
1077299602 11:1840915-1840937 GGTGGCGGCGGGCCGGCGGCAGG + Intronic
1077322132 11:1947249-1947271 GGGGGGGGCGGCGCGGCCTCCGG + Intergenic
1077386197 11:2270631-2270653 GACGGCGGCGGCGCGGAGGAGGG - Exonic
1077485312 11:2835802-2835824 CATGGAGGCGGCGGGGCAGCGGG + Intronic
1078771691 11:14358343-14358365 GACGGTGAAGGCGCGGCCGCAGG + Intronic
1079353417 11:19712435-19712457 GATGGGGGCAGCGAGGCTGCGGG + Intronic
1080588335 11:33700505-33700527 GGTGGCGGGGGCGGGGGCGCCGG + Exonic
1081460608 11:43269340-43269362 GATGGCAGCAGCGCAGCCACAGG - Intergenic
1081709754 11:45209164-45209186 GATGGTGGGGGCCCGGCCCCCGG - Intronic
1081851499 11:46277952-46277974 GACGGAGGCGGCGCGGCCCCGGG - Exonic
1082059483 11:47848297-47848319 GATGGCGGCGGCGGGAGCCCTGG - Exonic
1082833858 11:57638492-57638514 GCGGGTGGCGGGGCGGCCGCTGG + Intergenic
1083560726 11:63671194-63671216 AAGGGCGGCGGCGCGGGCGGGGG + Intronic
1083664991 11:64269439-64269461 GCTGGCAGCAGCGCGGTCGCTGG - Intergenic
1083849096 11:65354992-65355014 TATGTCGGCGGGGCGGCCCCAGG - Intronic
1083945047 11:65919010-65919032 GATGGCGGCGGCGGCGGCGGCGG - Exonic
1084000199 11:66291931-66291953 GAGGGCTGCGACGCGGCCCCCGG - Exonic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1084385446 11:68840886-68840908 GCTGGGAGCGGCGGGGCCGCGGG - Intronic
1085043971 11:73342954-73342976 GAGCGCTGCGGCCCGGCCGCCGG - Intronic
1085266550 11:75241010-75241032 GAGCGCGGCGGCCCGGGCGCTGG + Exonic
1086590481 11:88509178-88509200 GAGCGCGGCCGCGCGGGCGCCGG + Exonic
1088522141 11:110711936-110711958 GGAGGCGGCGGCGCTGCCGCTGG + Intronic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1089511162 11:118998149-118998171 GATGGCGTAGGATCGGCCGCTGG + Exonic
1089557286 11:119321375-119321397 GATGGCAGCGTCGGCGCCGCGGG + Intronic
1202805150 11_KI270721v1_random:2562-2584 GGGGGGGGCGGCGCGGCCTCCGG + Intergenic
1091434051 12:459984-460006 GCTGGCGGGGGCGCGGGCGGAGG + Intergenic
1093958759 12:25250779-25250801 GAAGGCGGCGGCGGGGCCAGAGG - Exonic
1095049505 12:37543725-37543747 AATGGCAGCTGCGCGGCGGCAGG - Intergenic
1095206106 12:39442676-39442698 GCTGGCGGCTGCGCGGCGCCGGG - Intronic
1095752373 12:45727547-45727569 GGCGGCGGCGGCGCGGCGGCAGG + Intergenic
1095875966 12:47080057-47080079 GGAGGAGGCGGCGAGGCCGCGGG - Intronic
1097190418 12:57216869-57216891 GCGGGCGGCGGGGCGGCTGCGGG - Exonic
1097218141 12:57430486-57430508 GAGGGCGGCGGTGCGGGGGCAGG - Intronic
1100611530 12:96194901-96194923 GGTGGCAGCGACGCGGGCGCAGG - Intronic
1102157481 12:110742729-110742751 GCCGGCGGCGGCGCCGCTGCGGG - Exonic
1102278215 12:111598871-111598893 GACGGCGAAGGCGCGGCGGCGGG + Exonic
1102278349 12:111599372-111599394 GGCGGCGGTGGCGCGGCCCCGGG - Exonic
1103779406 12:123389129-123389151 GGTGGCGGCGGCGAGGGCGCGGG + Intronic
1104046949 12:125170043-125170065 GATGGCGGGGAAGCAGCCGCTGG + Intergenic
1104049498 12:125186290-125186312 GAGGGCGGGGCCGCGGCCGGGGG - Intergenic
1105512126 13:21060607-21060629 TGAGCCGGCGGCGCGGCCGCGGG + Intronic
1105745665 13:23375321-23375343 GGTGGAGGCCGCGCGGGCGCTGG - Intronic
1108292663 13:48976440-48976462 GCTTGCGGGGGCGCGGCCGGGGG + Intronic
1108541614 13:51452131-51452153 TGTGGGGGCGGCGGGGCCGCTGG - Intronic
1110706213 13:78603437-78603459 GCTGGCGGCGGCCCCGCCGCGGG + Exonic
1113201068 13:107867601-107867623 GCGGGCGGCGGCGGGGCCGCGGG + Intergenic
1113311920 13:109140599-109140621 GACGACGGCGGCCCGGGCGCGGG + Exonic
1113378666 13:109784933-109784955 GGCGACGGCGGCGCGGCGGCGGG - Exonic
1114519004 14:23321469-23321491 GATGGCGGCGGCGGCGGCGGCGG + Exonic
1114525706 14:23365947-23365969 GAGGGCGGCGGAGCCGGCGCCGG - Intergenic
1115028333 14:28767235-28767257 GGCGGCGGCGGCGCGGGAGCGGG - Exonic
1115235795 14:31207674-31207696 GACGGCGGCGGCGGCGCGGCGGG + Intronic
1115398580 14:32934891-32934913 GCGGCCGGCGGGGCGGCCGCGGG + Intergenic
1115851787 14:37595148-37595170 GGCGGCGGCGGCGCGGCGGGCGG + Intronic
1116835798 14:49768212-49768234 GGCGGCGGCGGCGCGGGCCCGGG - Exonic
1117388538 14:55240968-55240990 GATAGCCGCGGCGGGGCCGGGGG + Intergenic
1117913871 14:60657346-60657368 GCCGGCGGCGGCGCGGCCGGAGG + Intronic
1118265781 14:64294107-64294129 GGTGGCGGCGGGGCGCGCGCCGG - Exonic
1118339100 14:64879831-64879853 GGTGGCGGCGGCGGCGGCGCAGG + Exonic
1118809217 14:69261213-69261235 GGGGGCGGCGGCGGGGCTGCGGG + Intronic
1118911345 14:70064548-70064570 GGTGGCGGCGGCGGGGATGCTGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1122993300 14:105248982-105249004 GGCGGCGGCGGCGCTGGCGCGGG - Exonic
1123423255 15:20148293-20148315 GACAGCGGCGGCGCGGCGGAGGG + Intergenic
1124971486 15:34494383-34494405 GGAGGCCGCGGCGCGGCCCCGGG - Intergenic
1125508790 15:40282038-40282060 GGCGGCGGCGGCGCGGCCCCAGG + Exonic
1125539578 15:40462210-40462232 GACGGCGGCGGCGAGGGCGTGGG - Exonic
1126034956 15:44537194-44537216 GATGGCGGCGGCGGCGGCGGCGG + Exonic
1128161042 15:65422969-65422991 GCGGGCGGGGGCGCGGCCTCGGG + Exonic
1128344128 15:66842820-66842842 GGCGGCGGCGGCGCCGGCGCGGG + Intergenic
1128735253 15:70049991-70050013 GATGGCGGAGGATGGGCCGCAGG - Exonic
1128877609 15:71215074-71215096 GACGGCGGCGGCGGCGCCCCGGG + Exonic
1129116415 15:73367768-73367790 GGCGGCGGCGGCGAGGCTGCGGG + Exonic
1129189134 15:73927405-73927427 GCGGGCGGCGGCGTGGGCGCGGG + Exonic
1129269498 15:74411912-74411934 GATGGCAGCCGCGCGGCGGAAGG + Exonic
1129447008 15:75625680-75625702 GGTGGCGGCGGCGCGTGCGACGG - Exonic
1130046615 15:80450740-80450762 GATGATGGCAGAGCGGCCGCAGG + Intronic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131272683 15:90956734-90956756 CATGGCGGAGGAGCGGCCGGGGG + Exonic
1131466093 15:92655803-92655825 GGTGGCGGCGGCGGTGGCGCGGG - Exonic
1131692785 15:94845007-94845029 GGAGGCGGCGGCGCTTCCGCGGG + Intergenic
1132079488 15:98852344-98852366 CACGGCGGCGGCGCGGGCGCGGG - Intronic
1132527678 16:425771-425793 CATGGCGGCGGGGCGGCCTAGGG - Exonic
1132560193 16:590039-590061 AATGGCGGCGGCGCGGCCGGGGG + Intronic
1132656570 16:1044052-1044074 GCCGGCGGCGGCGGGGGCGCCGG + Intergenic
1133325061 16:4937180-4937202 GCTGGGGGCGGGGCGCCCGCCGG + Intronic
1133802029 16:9092010-9092032 GGCGGTGGCGGCGAGGCCGCGGG + Exonic
1134104606 16:11476853-11476875 GCTGGCGGCGCTGCGGACGCTGG + Exonic
1135016161 16:18926428-18926450 GACAGCGGCGGCGCGGCGGGCGG - Exonic
1135437190 16:22437010-22437032 GATAGCGGCGGCGCGGCCAGCGG + Intronic
1135821911 16:25692463-25692485 GGCGGCGGCGGCGCGGCCAGAGG - Exonic
1136146592 16:28320014-28320036 GAGGGCGGCGGGGCGGGCGCTGG + Intronic
1136399789 16:30011060-30011082 GATGCAGCCGGCGCGGCGGCGGG + Exonic
1136419537 16:30123188-30123210 GATGGCGGCGGCGGCGGCTCAGG - Exonic
1136447938 16:30335393-30335415 GACAGCGGCGGCGCGGCGGGCGG - Intergenic
1136454030 16:30370303-30370325 GCCGGGGGCGGAGCGGCCGCTGG + Intergenic
1138105713 16:54286219-54286241 GACGGCGGCGGCGAGGGCGGCGG + Exonic
1138360811 16:56425622-56425644 CTAGGCGGCGGCGCGACCGCTGG - Intergenic
1138514542 16:57528919-57528941 GCTGGAGGAGGCGCGGGCGCGGG - Exonic
1138619101 16:58197773-58197795 GGTGGCGGCGGCGGCGCGGCGGG + Exonic
1139403007 16:66696854-66696876 GGTGGAGGCGGCGGCGCCGCGGG + Intergenic
1139473743 16:67192227-67192249 GATGGCGGAGGCCGGGCCACAGG + Exonic
1139480318 16:67226977-67226999 GATGGCGGAGTCGCTGCCCCTGG - Intronic
1139496933 16:67326766-67326788 GGTCGCGGCGGCGCGCGCGCGGG + Intergenic
1141699030 16:85634025-85634047 GCTGGTGGCGGGGCTGCCGCTGG - Exonic
1141831314 16:86511248-86511270 GGCTGCGGCGGCGCGGCGGCCGG + Exonic
1141989643 16:87602672-87602694 GAGGGCGGCGGCGGGGCCCGCGG - Intronic
1142005979 16:87689810-87689832 GCGGGCGGCGGGGTGGCCGCGGG - Exonic
1142336099 16:89490357-89490379 GGCGGCGGCGGCGCGGGCTCGGG + Exonic
1142623732 17:1179936-1179958 GCTGGGCTCGGCGCGGCCGCTGG - Intronic
1142695156 17:1629222-1629244 GGGGACGGCGGGGCGGCCGCGGG - Intergenic
1142974577 17:3636017-3636039 CCTGGAGGCGGCGCGGCCCCGGG + Intronic
1143371641 17:6444246-6444268 GCTGGCGGCGGGGCGGGGGCCGG + Intergenic
1143558112 17:7675126-7675148 GATGGCCATGGCGCGGACGCGGG + Exonic
1144828798 17:18120820-18120842 GAGAGCGGCGGCGCGGGCGGGGG - Exonic
1144862668 17:18315305-18315327 GATGGCGGCGCCGCGGTAGCAGG + Exonic
1145031319 17:19507367-19507389 GATGGCGGCGCGGGGGACGCGGG - Intronic
1145041279 17:19579891-19579913 GCTGGCGGCGGCGCGGGCGCGGG - Intergenic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146182946 17:30709090-30709112 GAGAGGGGCGGCGCGGCCGGAGG - Intergenic
1146958156 17:36949125-36949147 GATGGCGGGGCCGCAGCCCCTGG + Exonic
1147028395 17:37609309-37609331 TCTGGTGGCGGCGGGGCCGCGGG - Exonic
1147158613 17:38558315-38558337 GTCGGAGGCGGCGCGGCGGCAGG - Exonic
1147564437 17:41527805-41527827 GTGGGCGGAGGCCCGGCCGCGGG - Intronic
1147994635 17:44354061-44354083 GGCGGCGGCGGCGCGGCAGGCGG + Exonic
1148271789 17:46267159-46267181 CGGGGCGGCGGCGCGGCGGCCGG - Intergenic
1148482786 17:47971021-47971043 GAAGGCGGCGACGTGGCCGAAGG + Intronic
1148768987 17:50056198-50056220 GACGGCGGCGACCCGGCCGCTGG + Intronic
1149461541 17:56833696-56833718 GATGCCGGCGCCGCCGCCGCCGG - Exonic
1150764596 17:67993395-67993417 CGGGGCGGCGGCGCGGCGGCCGG + Intronic
1150764626 17:67993546-67993568 CGCGGCGGCGGCGCGGGCGCGGG + Intronic
1151821877 17:76501139-76501161 GACGGCGCCGGCGGGGCCGCTGG - Intronic
1152627997 17:81397001-81397023 GGTGGCGGCGTCGCCGCTGCGGG + Intronic
1153285154 18:3449995-3450017 GGGGGCGGCGGTGCGGACGCGGG - Intronic
1153515140 18:5895364-5895386 AGGGCCGGCGGCGCGGCCGCAGG - Exonic
1153900652 18:9614600-9614622 GCTGGCGGGGGCGCGCGCGCGGG + Intronic
1153999910 18:10474209-10474231 GATGGCGGCCGGGCGGACGGTGG - Intronic
1154241502 18:12657763-12657785 GCAGCCGGCGGCGCGGCCGGGGG - Exonic
1155221468 18:23689686-23689708 GGCGGCGGCCGCGCGGCCTCGGG + Exonic
1157279098 18:46334179-46334201 GCGGGCGGCGGCGGGGCTGCGGG - Intronic
1157609980 18:48950165-48950187 GCGGGCGCCGGCGCGGCCGGGGG - Exonic
1159511351 18:69401119-69401141 GCGGGCGGCGGCGCTGCTGCTGG + Exonic
1159798033 18:72867588-72867610 GACGGCGGCGGCGCGGATGGTGG - Exonic
1160454786 18:78992794-78992816 GATGGCGGCGGCAGGGGCCCCGG - Exonic
1160680342 19:409221-409243 GGGGGCGGGGGCGCGGGCGCGGG - Intergenic
1160830679 19:1103720-1103742 GTTGACAGCAGCGCGGCCGCAGG - Intergenic
1160909399 19:1467856-1467878 GTTGGCGTGGGCGCGGCCGCCGG - Exonic
1160961908 19:1725839-1725861 GCTGGCGGCGGCCCGGGCCCCGG + Intergenic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1160975131 19:1789335-1789357 GGTGGCGGCGGCGGGGCTGGGGG - Intronic
1161016810 19:1987373-1987395 GAAGACGGCGGGGGGGCCGCCGG - Intronic
1161022162 19:2015599-2015621 GGTGGCGGCGGCGTTGGCGCTGG + Exonic
1161203647 19:3029220-3029242 GGTGGCGGCGGCGCGGGCGGCGG + Intronic
1161216688 19:3098285-3098307 GATGGCGGCGGCGCGGACGGAGG - Intronic
1161388155 19:4007829-4007851 GAGGGCGGGGGCCGGGCCGCAGG + Intronic
1161973330 19:7595983-7596005 CATGGCGGCGCCGGGGCTGCGGG - Exonic
1162030914 19:7916916-7916938 GATGGCGGCGGCGGCGGCGGCGG - Exonic
1162033244 19:7926170-7926192 GACGGGGGCGGGGCCGCCGCGGG + Intergenic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162931961 19:13961976-13961998 GAGGGCGGGGGCGCGGGGGCTGG + Exonic
1162975852 19:14206678-14206700 GAGGGGGGCGGCGCGGCTGGAGG + Intergenic
1163146157 19:15380252-15380274 GGTGGCGGCGACACGGCCCCGGG + Exonic
1163557601 19:18001413-18001435 GGAGGCGGCGGCGCCGCTGCGGG + Intronic
1163607052 19:18281273-18281295 GTAGGAGGCGGCGCGGCCGCAGG + Exonic
1163720462 19:18896051-18896073 TATGGCGGCGGCGGGGCCCGCGG - Exonic
1164149015 19:22532704-22532726 GACGGAAGCGGCGGGGCCGCCGG + Intergenic
1164155746 19:22596038-22596060 GCGGGCGGGGGCGGGGCCGCAGG - Intergenic
1164658573 19:29942450-29942472 GAGGGCGGGCGCGCGGGCGCTGG + Exonic
1165300143 19:34963641-34963663 GATGGCAGCGGCGGCGCTGCGGG - Exonic
1165349830 19:35269387-35269409 GGGGGCGGGGGCGCGGGCGCGGG + Intronic
1165595296 19:37007717-37007739 GGTGGCGGCGCGGCGGCCTCGGG - Intergenic
1165596116 19:37012249-37012271 AATGGCGGCGGCGCGGCGGTAGG - Intronic
1166097360 19:40549242-40549264 GCAGACGGCGGCGCTGCCGCTGG + Exonic
1166714060 19:44955395-44955417 GATGGCGGCGGCGCAGGAGGCGG + Exonic
1166784880 19:45361694-45361716 GATGGCGGAGGCAGGGCTGCTGG - Intronic
1166809887 19:45508542-45508564 GAGGGAGGGGGCGCGGCAGCTGG + Intronic
1166869526 19:45863114-45863136 GATGGCGGCGGCGGCGGCGGCGG - Exonic
1166984176 19:46649666-46649688 GAGGGCGGCCGCAGGGCCGCGGG + Exonic
1167019066 19:46861006-46861028 GAGAGCCGCGGCGCGGCGGCAGG + Intergenic
1167080729 19:47274797-47274819 GCTGGCGGGGGCGGGGCCGGAGG + Exonic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167466270 19:49652376-49652398 GAGGGCGGCGGGGCGGGCGCCGG - Exonic
1167578499 19:50328979-50329001 GGTGGCGGCGGCGGGGACTCGGG + Exonic
1168571878 19:57477288-57477310 GATGGCGGCGGCTGAGCCGATGG - Exonic
925361601 2:3284098-3284120 GAAGGCCGCGGCACGGCTGCAGG + Intronic
927472214 2:23385238-23385260 GGCGGCGGCGGCGCGGGGGCTGG - Exonic
927751458 2:25673717-25673739 GGTGGGCGGGGCGCGGCCGCGGG - Intergenic
927957387 2:27217350-27217372 GACTGCGGCGGCGCGGACACAGG - Intergenic
929501380 2:42493941-42493963 GACGGCGGCGGGGCGGCCGCCGG - Exonic
930618952 2:53624732-53624754 GATGGCGGTGGGGTGGCCTCTGG - Intronic
930730671 2:54724903-54724925 GATGGTGGCGGCCGGCCCGCTGG + Exonic
931614647 2:64144028-64144050 GATGGCGGCGGGGCCGCCGAGGG - Intronic
932562730 2:72887370-72887392 GCAGGAGGCGGTGCGGCCGCGGG - Exonic
933560237 2:83878123-83878145 GATGGCGGCGGCGGTGCAGAAGG + Intergenic
934566974 2:95346591-95346613 GGCGGCGGCGGCGCGGCGGCGGG - Intronic
935592740 2:104856237-104856259 GGCGGCGGCGGCGCGGGCGGTGG + Exonic
936390778 2:112071303-112071325 GGTGGCGGCGGCGGGGGGGCGGG - Intronic
938614011 2:132979051-132979073 GATGTGGGCAGCGAGGCCGCAGG - Intronic
940036877 2:149320677-149320699 GATGGCGGCGCCGCGGCCTGGGG - Intergenic
940226872 2:151409889-151409911 GATGGCGGCTGGGCGGGCCCAGG - Intronic
942346231 2:175005340-175005362 GATGGCGTCTGCGAGGCCGCGGG - Intronic
942446145 2:176080249-176080271 GGCGGCGGCGGCGGGGGCGCCGG - Exonic
942471974 2:176269694-176269716 GAAGGTGGCGGCGCGGTCTCGGG + Intronic
944553166 2:200864205-200864227 GATGGCGGCTGGGCGGAGGCCGG - Exonic
945119582 2:206443796-206443818 GCTAGCTGCGGGGCGGCCGCGGG - Exonic
946397128 2:219448806-219448828 GAGGGCGGCTGGGCGGCGGCGGG - Exonic
946921403 2:224585105-224585127 GGCGGCGGCGGCGCGACCCCCGG + Exonic
946921469 2:224585305-224585327 GATGGCGGCGGCGGCGGCGACGG + Exonic
947542789 2:230990371-230990393 GAAGGCGGAGGCGCAGCCACAGG + Intergenic
948492144 2:238320565-238320587 GGCGGCGGCGGCGGGGCCGGCGG + Exonic
948696876 2:239737253-239737275 GGTGGCGGCAGCGGGGCCCCGGG - Intergenic
948806068 2:240453817-240453839 CAGGGCGGCGACGCTGCCGCCGG + Intronic
948824794 2:240568917-240568939 GGGGGCGGCGGCGCGGGCCCCGG - Exonic
1168913249 20:1466803-1466825 GATGGCGGCGGAGCGACAGGAGG - Exonic
1169220659 20:3820536-3820558 AATGGCGGCTGCGCGGCCCGTGG - Exonic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1172587137 20:36092789-36092811 GGCGGCGGCGGCGCGGCTTCCGG - Intronic
1173822666 20:46029325-46029347 CATGGTGGCGGCGCGGCCCCTGG - Intronic
1173856040 20:46251389-46251411 GGTGGCCTCAGCGCGGCCGCCGG + Exonic
1174607023 20:51768431-51768453 GCGGGCGGCGGCGCGGAGGCCGG - Exonic
1175902942 20:62367137-62367159 GCTGGGCGCGGCGCGGGCGCGGG - Exonic
1176125392 20:63472658-63472680 GGCGGAGCCGGCGCGGCCGCGGG - Intergenic
1176286362 21:5021284-5021306 GAGGGCGGCGGCGAAGGCGCAGG - Intergenic
1176548359 21:8211520-8211542 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176550172 21:8217376-8217398 GCGGGCGGCGGAGGGGCCGCGGG + Intergenic
1176555711 21:8253274-8253296 CCTGACGGCGGCGCGGGCGCAGG - Intergenic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176567290 21:8394555-8394577 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176569100 21:8400414-8400436 GCAGGCGGCGGAGGGGCCGCGGG + Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176577014 21:8444646-8444668 GCGGGCGGCGGAGGGGCCGCGGG + Intergenic
1179444225 21:41420280-41420302 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1179810170 21:43865152-43865174 GGCGGCGGCGGCGCGGCCGAGGG + Intergenic
1179870819 21:44242191-44242213 GAGGGCGGCGGCGAAGGCGCAGG + Intergenic
1180042355 21:45287250-45287272 GATGGGGGCGGGGCGGGAGCCGG - Intronic
1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG + Intergenic
1180535048 22:16388785-16388807 GATGGTGGTGGAGCAGCCGCTGG + Intergenic
1180559046 22:16601352-16601374 AGCGGCGGCGGCGCGTCCGCGGG + Intergenic
1181147403 22:20858704-20858726 GATGGCGGCGGCCCCGGCCCGGG - Exonic
1182122936 22:27798706-27798728 GAAGGCGGCAGCACGGGCGCCGG - Exonic
1182422624 22:30256019-30256041 GCTGGCGGGGCCGTGGCCGCAGG - Intergenic
1183683772 22:39350210-39350232 CCCGGCGGCGGCGCGGCGGCGGG + Intronic
1184426234 22:44410727-44410749 GATGACGGTGGCGCAGCCGGAGG - Intergenic
1184568887 22:45309930-45309952 GTTTGCGGCGGCGCCGCTGCCGG + Intronic
1185051336 22:48555800-48555822 GATGGGGGCGCTGTGGCCGCTGG + Intronic
1185375767 22:50482014-50482036 GAGGGCGGCCCCGCGGCCCCCGG - Intronic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203255067 22_KI270733v1_random:133714-133736 GCGGGCGGCGGAGGGGCCGCGGG + Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203263123 22_KI270733v1_random:178793-178815 GCGGGCGGCGGAGGGGCCGCGGG + Intergenic
949461968 3:4303500-4303522 AAGGGCGCCGGCGCGGCCCCCGG - Exonic
950153843 3:10708045-10708067 GCGGGCGGCGGCGGGGCCGCGGG - Intergenic
950215279 3:11154467-11154489 GGGGGCGGCGGCGGGGGCGCCGG - Intronic
951717390 3:25664263-25664285 GGTGGCTGCGGCGCGGGAGCCGG - Exonic
953485070 3:43286896-43286918 CCTGGCGGCGGGGCGGCGGCGGG + Intronic
954401361 3:50321388-50321410 GATGGCGGTGGCCCTGGCGCCGG - Exonic
954615557 3:51967351-51967373 GGCGGCGGCGGCACGGCGGCTGG + Exonic
955216020 3:56985696-56985718 GATCGAGGGGGCGAGGCCGCAGG - Intronic
955818800 3:62874863-62874885 GGGGGCGGCGGCGCCGGCGCCGG - Exonic
958638592 3:96777073-96777095 GAGGGCGGCGGGGCGGGCGCAGG + Intergenic
962222355 3:133574186-133574208 GCGGGCGGCGGGGCGGGCGCGGG + Exonic
963835156 3:150050725-150050747 GATGGCGGCGGCGGCGGCGGGGG + Intronic
966182250 3:177197694-177197716 GGCGGCGGCGGCGCGGCGGGGGG + Intergenic
966696278 3:182793513-182793535 GGTGGCTGCGGCGCGGCGGCAGG + Exonic
966936327 3:184711987-184712009 GCTGGCGGCGTTGCGGCCGCAGG - Exonic
967596259 3:191329445-191329467 GGTGGCCGCGGCGGGGCAGCTGG + Exonic
967685276 3:192409903-192409925 GGAGGCGGCGGCGCGGCGGCGGG - Intronic
968178188 3:196569036-196569058 AGCGGCGGCGGCGCGGGCGCGGG + Exonic
968405498 4:336753-336775 GATGGCGACGCTGCAGCCGCTGG - Intergenic
968434106 4:576189-576211 GGCGGCGGCGGCGCGGGCCCGGG - Intergenic
968660082 4:1795238-1795260 GGTGCCGGAGGGGCGGCCGCGGG + Intronic
968701204 4:2059094-2059116 GGGGGCGGCGGCGCGGGCGGGGG - Intergenic
968923062 4:3532526-3532548 GCCGGCAGCGGCGAGGCCGCCGG + Exonic
968965367 4:3766621-3766643 GCTGGCGGCGGCGCTGGCGGTGG + Exonic
970456222 4:16226555-16226577 GATGGCGGCGGCGGCGGCGGCGG - Intronic
971196218 4:24473115-24473137 GAAGGCGGCCGGCCGGCCGCGGG - Intergenic
971406033 4:26321265-26321287 GGCGGCGGCGGCGAGGCCGGCGG + Intronic
971457810 4:26860798-26860820 GGCGGCGGCGGCGCGGGAGCTGG + Intronic
972396525 4:38663740-38663762 TCGGGCGGCGGCGCGGCGGCTGG + Intergenic
975420523 4:74158375-74158397 GTGGGCGGCCGCGCGGCGGCGGG + Intronic
975973711 4:80072539-80072561 GATGGTGGCGGAGCGGTCCCCGG - Exonic
976398562 4:84583110-84583132 GAAGGCGGAGACGCGGCCTCCGG - Exonic
977689906 4:99894523-99894545 GAGGGGAGGGGCGCGGCCGCCGG - Intergenic
979349682 4:119629036-119629058 GAAGGAGGCCGCGCGGCCGCTGG + Intergenic
980130505 4:128812091-128812113 GCTGGCGGCGGCGGGGCGGGAGG + Intronic
980355635 4:131729943-131729965 AATGGCGGTGACGCGGCTGCCGG - Intergenic
981429889 4:144646235-144646257 GACGGCGGCGGCGGGGCAGGCGG - Exonic
984206480 4:176792807-176792829 GAGGGCGGCGGGGCGGCTGGCGG + Intergenic
984886707 4:184456083-184456105 GATGGTGGGTGTGCGGCCGCAGG - Intronic
985895570 5:2748623-2748645 GAGGCCGGCGCGGCGGCCGCGGG + Exonic
985996912 5:3602219-3602241 GATGGCCGCGGCCGGGCAGCGGG + Intergenic
986165941 5:5271476-5271498 GATGGGGGCGGGGCAGCCGCGGG - Intronic
986321155 5:6633501-6633523 TAGGGCGGCGGCGCGGGGGCAGG - Exonic
986330800 5:6714594-6714616 GAGAGCGGCCGCGCGGCTGCCGG - Exonic
986608629 5:9546184-9546206 GGAGGAGGCGGCGCGGCGGCGGG - Intergenic
986813665 5:11385174-11385196 GGCGGCGGCGGCGCGGGCTCGGG + Exonic
989287707 5:39721585-39721607 TGTGGAGGCGGCGGGGCCGCTGG - Intergenic
989581990 5:43042073-43042095 GACGCCGGCGGCGCCGCCACAGG + Intronic
990545165 5:56815359-56815381 GAGGGCGGCCCGGCGGCCGCAGG - Intergenic
990955119 5:61332699-61332721 GGCGGCGGCGGCGCGGGCGGCGG + Exonic
992105720 5:73448028-73448050 GGCGGCGGCGGCGCGGGCGGCGG - Exonic
993386540 5:87268506-87268528 GGAGGAGGCGGCGCGGCAGCGGG + Exonic
995047857 5:107670908-107670930 GGTGGCGGCGGCGAGGGCGGGGG + Intergenic
997539332 5:134648753-134648775 GATTGCGGCTGCGCGGCCGGCGG + Intronic
998200489 5:140114314-140114336 GGCGGCGGCGGCGGGGCCCCAGG + Exonic
999731197 5:154477818-154477840 GCGGGCGGCGGCCCGCCCGCAGG + Exonic
1000296337 5:159916377-159916399 GGTGGCGGCGTCGGGGCTGCGGG + Intergenic
1001286373 5:170426946-170426968 GAGGGAAGAGGCGCGGCCGCAGG + Intronic
1002029332 5:176416430-176416452 GGTGACAGCGTCGCGGCCGCCGG - Exonic
1002185989 5:177455048-177455070 CATGGCGGCGGCACGGGCGGCGG - Exonic
1002219947 5:177672218-177672240 GGTGGCGGCGGCGGGGGCGGCGG + Intergenic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1002927556 6:1613963-1613985 GATCGCAGCGGCGCTGGCGCGGG + Intergenic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1004193971 6:13487708-13487730 GCTGGCGGCGGCGGGGGCGGGGG - Intergenic
1006369211 6:33633807-33633829 GCTGGGGGCGGGGCGGGCGCGGG + Intronic
1006834024 6:36986070-36986092 GCTCGCGGCGGAGCGGCGGCGGG - Exonic
1010032897 6:71288841-71288863 CATGGCCGCGGCGAGGGCGCTGG - Exonic
1011734238 6:90296331-90296353 GAGGGCGGCTGCGCGCCCGGCGG + Intronic
1013099480 6:106974867-106974889 GGCGGCGGCGGCGGGGGCGCTGG - Intronic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1013507530 6:110815091-110815113 GCTGGCGGCGGAGCGGGAGCGGG - Exonic
1016330531 6:142947569-142947591 CAGGGCGGCGGCGCGGCCAGGGG - Intergenic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1017470417 6:154733312-154733334 GATGGTTTCCGCGCGGCCGCCGG + Intronic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1017719977 6:157236932-157236954 GATGGCGGCGGGGCAGCACCGGG - Intergenic
1017914314 6:158819468-158819490 GATGGCGGCAGCCGGGCCTCGGG + Intergenic
1018134552 6:160767150-160767172 GATGGCCAGGGCGAGGCCGCCGG - Intergenic
1019111905 6:169723944-169723966 GACGGCGGCGGCGGCGGCGCGGG - Exonic
1019404510 7:876645-876667 GATGGCGGCGGCGGCGGCGATGG + Exonic
1019563940 7:1670550-1670572 GGCGGCGGCGGAGCGGGCGCAGG + Intergenic
1019681858 7:2354991-2355013 GCTGGCGGCGGCTCGGCGGCCGG - Exonic
1019989593 7:4682411-4682433 GCCGGCGGGGGTGCGGCCGCGGG - Exonic
1020281785 7:6653553-6653575 TTCGGCGGCGGCGGGGCCGCGGG + Exonic
1021313147 7:19117053-19117075 GGCGGCGGCGGCGCGGGCGGCGG - Exonic
1021729957 7:23586401-23586423 GATGGCGGCGGCACTGCGGCCGG + Intergenic
1023064848 7:36367033-36367055 GGTGGCGGGGGCGCGGCGGGAGG + Intronic
1023638531 7:42236901-42236923 GGAGGCGCGGGCGCGGCCGCAGG + Intronic
1024472143 7:49775348-49775370 GCTGGCGGCGGCGCGCCCCCGGG + Exonic
1024930463 7:54663172-54663194 GACGGCGGCGGCTCCGCTGCAGG - Intergenic
1025296191 7:57776721-57776743 GATGGCGGAGCGGCGGCTGCGGG - Intergenic
1025806583 7:64838891-64838913 GATGGCGGCGGTGAGGAAGCAGG + Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1028762427 7:94510256-94510278 GGAGGCGGCGACGCGGCGGCTGG + Intronic
1029640404 7:101816402-101816424 GCTGGCGGCGGCGGCGGCGCGGG - Intronic
1030138697 7:106284560-106284582 GGCGGCGGCGGCGCGGCGGGGGG - Intronic
1031043548 7:116862917-116862939 GCGGGCGGGGGCGCGGGCGCGGG + Intronic
1033839877 7:145360684-145360706 TATGGCGAGGGCGGGGCCGCCGG + Intergenic
1034192723 7:149224075-149224097 GGGGGCGGCGGCGCGGAGGCGGG + Exonic
1034227992 7:149497693-149497715 GACGGAGGCGGCGCGACTGCGGG - Exonic
1034426923 7:151018799-151018821 GAAGGCGGCGGCGGGGCGGTAGG + Exonic
1034618273 7:152436655-152436677 AGCGGCGGCGGCGCGTCCGCGGG - Intergenic
1035153338 7:156893005-156893027 GACGCGGGCGGCGCGGCGGCGGG - Exonic
1035160816 7:156949135-156949157 GTTGGCGGCGGCGACGACGCTGG - Intergenic
1035168597 7:157005764-157005786 AAGGGCGGCGGCGGGGGCGCGGG - Exonic
1035751844 8:2002038-2002060 GCAGGCGGCGGCGCAGCAGCAGG - Exonic
1036482596 8:9151546-9151568 AAAGGGGGCAGCGCGGCCGCGGG - Intronic
1036645486 8:10609411-10609433 GATGGCGGCCGAGCTGCAGCAGG - Exonic
1037769201 8:21789116-21789138 GGTGGCGGCGGCGGCGGCGCCGG + Intronic
1037928802 8:22865378-22865400 GGTGGCGGCGGCGGGACCCCGGG + Intronic
1038963496 8:32548072-32548094 GGGGGTGGCGGCGCGGCTGCCGG - Intronic
1039595447 8:38787095-38787117 GAAGACGGCCGCGCGCCCGCCGG - Intronic
1040038827 8:42896724-42896746 GGTGGCGGGGGCGCGCCCGGCGG + Intronic
1040355862 8:46617603-46617625 CATGCCGGCGGCGGGGCTGCTGG + Intergenic
1043148337 8:76682468-76682490 GCTCTCGGCGGCGCGGGCGCGGG + Intronic
1043463707 8:80486040-80486062 GGGGGCGGGGGTGCGGCCGCGGG - Intronic
1046131643 8:109974457-109974479 GAGGGCGGTGGCACGGCCCCTGG + Exonic
1047292289 8:123541113-123541135 GACGGGGGCGGCGGGGCGGCGGG + Exonic
1047615089 8:126557205-126557227 GATGGCGGCGGCTTGCCCGACGG - Exonic
1049419486 8:142510588-142510610 GCTGGGGGCGGCGGGGGCGCGGG + Intronic
1049643780 8:143727196-143727218 GATGGCGCCCGCGCCGCCGCCGG + Exonic
1049660682 8:143818513-143818535 GATGGCGGCTCAGCGGCAGCGGG - Exonic
1049788524 8:144462611-144462633 GGCGGGGGCGGCCCGGCCGCGGG - Intronic
1050094247 9:2047312-2047334 GCGGGCGGCTGCGCGGCTGCGGG - Exonic
1050744123 9:8857670-8857692 GTTGGCGGCGGCGCGGGAGGCGG - Intronic
1052991783 9:34522918-34522940 GGTGGAGGCTGCGCGGCCGAGGG - Exonic
1053620517 9:39809730-39809752 GATGGCTGCGACGCGTGCGCAGG - Intergenic
1053626184 9:39874204-39874226 GATGGCTGCGACGCGTGCGCAGG + Intergenic
1053878689 9:42569028-42569050 GATGGCTGCGACGCGTGCGCAGG - Intergenic
1053893979 9:42725349-42725371 GATGGCTGCGACGCGTGCGCAGG + Intergenic
1054217704 9:62376497-62376519 GATGGCTGCGACGCGTGCGCAGG - Intergenic
1054232999 9:62532667-62532689 GATGGCTGCGACGCGTGCGCAGG + Intergenic
1054263640 9:62897713-62897735 GATGGCTGCGACGCGTGCGCAGG + Intergenic
1054434069 9:65196032-65196054 GGCGGCGGCGGCGCGGCGGGCGG - Intergenic
1054434075 9:65196050-65196072 GGCGGCGGCGGCGCGGCGGGCGG - Intergenic
1055090997 9:72364836-72364858 GGTGGCGCCGCCGCCGCCGCGGG + Intronic
1056747689 9:89318576-89318598 CATGGCGTCGGAGGGGCCGCGGG + Exonic
1057208129 9:93185195-93185217 GGGGGCGGCGGGGCGTCCGCGGG - Exonic
1057245609 9:93451890-93451912 GGCGGCGGGGGCGCGGGCGCGGG - Exonic
1057245611 9:93451896-93451918 CATGGCGGCGGCGGGGGCGCGGG - Exonic
1057758424 9:97854432-97854454 GATGGCGGCGGCGGCGGCGGCGG - Exonic
1059470931 9:114504710-114504732 GCGGGCGGCGGCGGGGGCGCGGG - Exonic
1060979708 9:127785376-127785398 GAAGGCGGAGGAGGGGCCGCGGG + Intergenic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061275928 9:129569272-129569294 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1061293654 9:129666011-129666033 GGTGGCGGCGGCCGGGCGGCTGG + Exonic
1061541020 9:131277834-131277856 GGCGGCAGCGGCGCGGCGGCGGG - Intergenic
1061961740 9:133992249-133992271 AGTGGCGGCAGTGCGGCCGCTGG - Exonic
1061975824 9:134067708-134067730 GGTGGCGGCGGCGGTGGCGCGGG - Intronic
1062084682 9:134642477-134642499 GGGGGCGGCGGCGCGCCCGCGGG - Intronic
1062362356 9:136193873-136193895 TAGGGAGGGGGCGCGGCCGCCGG - Intergenic
1062398869 9:136363742-136363764 GATGGCGGCGGGGCGGGGCCGGG - Exonic
1062412598 9:136432554-136432576 GAAGGTGGCGGAGCGGCTGCTGG - Exonic
1062435957 9:136546649-136546671 GATGGGGGCGCCGCGGCCTCTGG + Intergenic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203471465 Un_GL000220v1:116851-116873 GCAGGCGGCGGAGGGGCCGCGGG + Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203479286 Un_GL000220v1:160823-160845 GCAGGCGGCGGAGGGGCCGCGGG + Intergenic
1185432946 X:19877-19899 GAGGGCGGCGGAGGGGCCACGGG + Intergenic
1185442298 X:232699-232721 GAGGGCGGCGGAGGGGCCACGGG + Intergenic
1185506447 X:634904-634926 GACGGCGGCGGCCCGGGCGCAGG - Intronic
1185610592 X:1391947-1391969 GATGGCGGCGGCGATGCCTCCGG + Exonic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1190058134 X:47193991-47194013 GTTGGCGGCGGCGCGACCCGGGG + Exonic
1190730961 X:53225175-53225197 GATGGCGGCGGCGGCGCTGAAGG - Exonic
1191184226 X:57592521-57592543 GAAGGCCGCGGCGGGGCCGGGGG - Exonic
1191213167 X:57909938-57909960 GAAGGCCGCGGCGGGGCCGGGGG + Exonic
1192429120 X:71100802-71100824 CATGGAGGCGGCCCGGCGGCGGG - Exonic
1200058752 X:153474725-153474747 GGGGGCGGGGGCGCGGGCGCTGG + Intronic