ID: 902067636

View in Genome Browser
Species Human (GRCh38)
Location 1:13700844-13700866
Sequence CACATACACCCGTGGGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902067636 Original CRISPR CACATACACCCGTGGGTCTA TGG (reversed) Intronic
902067636 1:13700844-13700866 CACATACACCCGTGGGTCTATGG - Intronic
1063952206 10:11233935-11233957 CACATATGCCTGTGGGTGTAGGG - Intronic
1064104079 10:12486501-12486523 CACATGCACACGTGGGTACATGG - Intronic
1072292619 10:93978219-93978241 CACACACACCCGTGAATCAAAGG + Intergenic
1074836590 10:117301898-117301920 CACAAACACCCTTGAGTGTAAGG + Intronic
1075323685 10:121512691-121512713 CACATTCACCAGTGGTTCCAAGG - Intronic
1080587404 11:33694492-33694514 CACACACACCTGTGGGTGGAGGG - Intergenic
1089051907 11:115552957-115552979 AACATTCACCAGTGGGTCCAGGG + Intergenic
1089804564 11:121072002-121072024 CACATTCAGCCGTGAGTCTGAGG + Intronic
1091042668 11:132296650-132296672 CACACACACACCTGGGTCTTGGG - Intronic
1096203571 12:49703869-49703891 CACAGACACACTTGGGGCTAAGG + Intronic
1108999816 13:56784697-56784719 CACACACACACGTGTGTGTATGG + Intergenic
1110404685 13:75136589-75136611 GTCATTCACCCGTGGGTCTCAGG - Intergenic
1112797199 13:103069489-103069511 CACATACACACGTAAGTTTATGG + Intergenic
1119514557 14:75237785-75237807 CACACACACCCCCGGGTCTCTGG + Intergenic
1120026937 14:79596973-79596995 CACATACAGCAGTAAGTCTAAGG + Intronic
1133315542 16:4881524-4881546 CACATACACCTGTGGGAAAACGG + Exonic
1137646507 16:50079835-50079857 CACATAAAACCATGGCTCTAAGG + Intronic
1142968707 17:3596936-3596958 CACAAGCACCCGTGGGCCTGGGG - Exonic
1146304475 17:31720248-31720270 CACACACACATATGGGTCTAGGG + Intergenic
1154028836 18:10732311-10732333 CACAAACACACCTGGGTCTCAGG + Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1165283481 19:34817400-34817422 CACAAACACCCCAGGGTCTTGGG - Intergenic
1165355267 19:35300141-35300163 CACAATCACCGGGGGGTCTAAGG - Exonic
1165834734 19:38747239-38747261 CACCTACACCTGTGTGTCTTTGG + Intronic
938604603 2:132879481-132879503 CACATACCCACATGGCTCTAAGG - Intronic
940865668 2:158815531-158815553 AACATACTCCCATGGGTTTAGGG + Intronic
941609114 2:167638535-167638557 CACATACTCCAGTGACTCTAAGG + Intergenic
944888009 2:204084960-204084982 CACAGACAGCCGTGGGTTTCAGG + Intergenic
947709549 2:232304129-232304151 CAGATGCCACCGTGGGTCTACGG + Intronic
948006046 2:234608355-234608377 CACAGACATCCATGTGTCTAAGG - Intergenic
949008681 2:241666220-241666242 TACACACACCCGTGAGTCAATGG - Intronic
1173842146 20:46164819-46164841 CACATATATACGTGGGTCTCTGG + Intergenic
1174190511 20:48737271-48737293 CAGATAGACTCGTGGGTTTAGGG + Intronic
1180890734 22:19286607-19286629 CACACACACCCGTGTGTGTCTGG - Intronic
1182080208 22:27523442-27523464 AACATCCTCCCGTGGGTCTCTGG - Intergenic
1183755954 22:39764815-39764837 CACATACACCCGTGTGTATGTGG + Intronic
954783182 3:53075062-53075084 GACATACACCTGTGGGGCAAGGG - Intronic
964828328 3:160854625-160854647 CACATACACCCCTAGGAATACGG + Intronic
965578782 3:170245315-170245337 CACAGACCCCCGTAGGTTTAGGG - Intronic
965851005 3:173023321-173023343 CATATGCACACTTGGGTCTATGG + Intronic
965953155 3:174335151-174335173 CACATACACCCATAGGTCCCAGG - Intergenic
979654715 4:123179070-123179092 CACCTACACTCTTGGGTCCAGGG + Intronic
981888277 4:149704991-149705013 AACTTACACCCCTGGTTCTAAGG + Intergenic
988849750 5:35168592-35168614 TTAATAAACCCGTGGGTCTAAGG + Intronic
993550714 5:89270466-89270488 CACACACACACGAGGGTATAAGG + Intergenic
1003798821 6:9638352-9638374 CACATACACATGTAGGTCCAAGG - Intronic
1008274940 6:49532148-49532170 CACATACACCTGTTGGTGGAAGG - Intergenic
1008830329 6:55751767-55751789 CACACACACACGTGTGTATAGGG - Intergenic
1017255311 6:152326721-152326743 CACATACGCCCATGAGACTAAGG - Intronic
1021213788 7:17890023-17890045 CACATAAAACAGAGGGTCTAGGG + Intronic
1027246995 7:76374173-76374195 CACAGAAACCCCTGGGTCTTGGG + Intergenic
1037060042 8:14496456-14496478 CAAATACTCCCATGGGTGTATGG - Intronic
1039014897 8:33136207-33136229 CACAGAGACCTGTGGGACTATGG - Intergenic
1060910763 9:127348264-127348286 CACATCCACGTGTGGCTCTAAGG + Intronic
1061413091 9:130431509-130431531 CCCAAACACCCGTGGGGCTAGGG + Intronic
1061683947 9:132259506-132259528 CCCATTCACCTGTGGGTCTGTGG - Intergenic
1186344582 X:8678700-8678722 GACATACACAGGTTGGTCTAGGG - Intronic