ID: 902070062

View in Genome Browser
Species Human (GRCh38)
Location 1:13726872-13726894
Sequence ACTTCTATTCAGGGGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902070057_902070062 -5 Left 902070057 1:13726854-13726876 CCCATGAGACAGGAACATACTTC 0: 1
1: 0
2: 1
3: 13
4: 143
Right 902070062 1:13726872-13726894 ACTTCTATTCAGGGGCAGCAAGG 0: 1
1: 0
2: 1
3: 9
4: 117
902070058_902070062 -6 Left 902070058 1:13726855-13726877 CCATGAGACAGGAACATACTTCT 0: 1
1: 1
2: 0
3: 20
4: 238
Right 902070062 1:13726872-13726894 ACTTCTATTCAGGGGCAGCAAGG 0: 1
1: 0
2: 1
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902070062 Original CRISPR ACTTCTATTCAGGGGCAGCA AGG Intronic
900177024 1:1295460-1295482 ACTTCGACGCAGGGGCCGCAGGG - Exonic
901020267 1:6251757-6251779 ACTTCTCTCCATGGGCAGCCAGG - Intronic
902070062 1:13726872-13726894 ACTTCTATTCAGGGGCAGCAAGG + Intronic
904294469 1:29508952-29508974 ACCTCCATTCAGAGGCAACAGGG + Intergenic
906991080 1:50739598-50739620 ACTTCGTTTCAGGGTCATCATGG + Intronic
910227163 1:84947665-84947687 GCTTCCACTCTGGGGCAGCATGG - Intronic
915120444 1:153627137-153627159 ACCTCTCCTCAGCGGCAGCAGGG + Intronic
915537785 1:156547957-156547979 ACTACTATTCAGAGGCCGAAAGG + Intronic
917478917 1:175393701-175393723 GCTTGGAATCAGGGGCAGCAAGG - Intronic
917719543 1:177774040-177774062 ACTTCTATTCAGTGGTGGCCAGG + Intergenic
918694833 1:187532670-187532692 ACTTCCCTACAGGGTCAGCAAGG - Intergenic
921392953 1:214635347-214635369 ACTTCGCTTTAGGAGCAGCAAGG - Intronic
1065666940 10:28072995-28073017 ACTGCTGTCCAGGGGCTGCATGG - Intronic
1070109919 10:73475585-73475607 CCTTCCCTTCATGGGCAGCATGG - Intronic
1070543936 10:77438003-77438025 ACTTCTCTACACTGGCAGCATGG - Intronic
1074423188 10:113327572-113327594 TTTTTTATTAAGGGGCAGCAAGG + Intergenic
1080859789 11:36143255-36143277 ACTTTTAAGCAGGGGAAGCAAGG - Intronic
1084572642 11:69968791-69968813 ATTTCTGTCCAGGAGCAGCAGGG + Intergenic
1089393347 11:118117124-118117146 TCTTCTCTTCTGGGGCAGAAAGG - Intronic
1089985210 11:122806018-122806040 ACCTCTCTTCAAGAGCAGCAAGG - Intronic
1093691985 12:22119282-22119304 ACCTCTATTCAGGGGCACACAGG - Intronic
1096932871 12:55234546-55234568 AATTCTAGTCAGGGGCAGAAAGG + Intergenic
1097956752 12:65494736-65494758 CCTTTTACTCAGGGGGAGCAGGG + Intergenic
1098783807 12:74723171-74723193 ACTTCTGTGCAGGGGCAGGGAGG + Intergenic
1101160436 12:101968753-101968775 AGGTCTATTCAGTGGCATCATGG - Intronic
1104657679 12:130585746-130585768 ACTTCCCTGCAGGGGCAGCCTGG - Intronic
1106962698 13:35018768-35018790 ACTTCTATTCAGTGTTATCATGG - Intronic
1106988182 13:35381507-35381529 ACTTCTATTCCCGAGTAGCATGG + Intronic
1107750842 13:43564832-43564854 ATTTGTAGTCAGGGGCTGCAGGG - Intronic
1110108724 13:71715182-71715204 TCTACTATTCAGAGGCACCATGG - Intronic
1111156409 13:84333120-84333142 GCTTCTATTCAAGCGAAGCAAGG - Intergenic
1117140752 14:52789188-52789210 ACTTCAAAACAGTGGCAGCAGGG - Intronic
1117312290 14:54539882-54539904 ACTGCTAGTTAAGGGCAGCAGGG - Intergenic
1118644612 14:67825532-67825554 ACTTCTATGTATGGTCAGCAGGG + Exonic
1120204449 14:81572947-81572969 ACTTCTATTTTGGGTAAGCAGGG + Intergenic
1127043117 15:54998938-54998960 GCTTCTATTAATGGGCTGCAAGG - Intergenic
1128154888 15:65385953-65385975 ACTCCAATTCATGGGCAGCTGGG + Exonic
1129170825 15:73806820-73806842 ACTTCTATAAAGGGCCAGCGGGG - Intergenic
1131464533 15:92644840-92644862 ACCTCTGTTCCGGGGCAGCCGGG - Intronic
1134124266 16:11605509-11605531 ACTCCTAGGCAGGGGCCGCAAGG + Intronic
1136615880 16:31398063-31398085 ACTTCTACCCTGGAGCAGCAGGG - Intronic
1140672242 16:77290803-77290825 ACTCCTATTCAGGGGTAGTATGG - Intronic
1142652324 17:1363134-1363156 ACTTCTAGTATGGAGCAGCATGG - Intronic
1142677452 17:1522762-1522784 GCTTATATTCTGGGGCAGGATGG + Intronic
1143378423 17:6480661-6480683 ACTTTCAGTCAGGGGCAGGAGGG - Intronic
1143390669 17:6557327-6557349 ACTTCTGTTTAGGGGCAGCAGGG + Intergenic
1153244129 18:3057046-3057068 ATTTCTATCCAGAGGCAGCTGGG + Intergenic
1157086205 18:44582448-44582470 ACTTCTGCTCAGGGCCTGCAGGG - Intergenic
1163184847 19:15630315-15630337 ACTACTAGACAGGGGAAGCAGGG - Intronic
1163723557 19:18909994-18910016 ACTCCTGTGCAGAGGCAGCATGG - Intronic
1167251482 19:48400641-48400663 TCTTCCATCCAGGGGCAGCACGG - Intronic
925270957 2:2607051-2607073 ACATCTCTTCAGAAGCAGCATGG - Intergenic
927163266 2:20290735-20290757 ACTCCCAATCAGGGTCAGCAAGG - Exonic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
928865568 2:35913691-35913713 TCTTCTATTCAAGGGAAGAATGG - Intergenic
929386879 2:41418929-41418951 ACTTCTCTTCAAAGGCATCAAGG + Intergenic
931121478 2:59225205-59225227 TCTTCTGTTAAAGGGCAGCAGGG - Intergenic
931771229 2:65499871-65499893 AAGTCTATTAAGGTGCAGCACGG + Intergenic
935414050 2:102796614-102796636 AGTTGTATTCAGGCTCAGCAGGG - Intronic
935632959 2:105227136-105227158 CCTTCTAGACAGGGGTAGCATGG - Intergenic
937039147 2:118807651-118807673 ACTTCTATTCAGGGTTCACAGGG + Intergenic
938639801 2:133266590-133266612 CCTTCACTTCGGGGGCAGCAAGG + Intronic
940231580 2:151459415-151459437 TTTTCTATTCAGGAGCAGCTAGG + Intronic
944085066 2:195836224-195836246 ACCTATGTTCAGGGCCAGCATGG + Intronic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
1175935603 20:62512555-62512577 AGTTATATTAAGGAGCAGCAGGG - Intergenic
1179597406 21:42452113-42452135 GCTGGGATTCAGGGGCAGCAAGG - Intergenic
1179938028 21:44617266-44617288 AGTTCTACTCAGGGACAGCTTGG + Intronic
1181516747 22:23418521-23418543 GCATGTATTCAGGGGCAGCAAGG - Intergenic
1182579025 22:31292716-31292738 AATTCTATCAAGGGGCATCATGG + Intergenic
1184988699 22:48153346-48153368 GCTTCAATTCAGGGACAGCCGGG - Intergenic
950607632 3:14096819-14096841 ATTTCTGATGAGGGGCAGCAAGG - Intergenic
953439790 3:42907432-42907454 AGTCCTATACAGGGGCAGCAGGG + Intronic
954468591 3:50673535-50673557 ACTTCTTTTTAGGGGTAGCAGGG - Intergenic
962030294 3:131592675-131592697 GCTTCTATTAAGAGGTAGCATGG - Intronic
969070791 4:4537058-4537080 ACTGCTGTGCAGAGGCAGCAGGG - Intronic
969086025 4:4657082-4657104 ACTTCTATTCATGGGCTGTGTGG + Intergenic
969388028 4:6869389-6869411 AGTGCTACTCAGGGGGAGCAAGG - Intronic
969701809 4:8771744-8771766 ACATTTATTCAGGGCCTGCACGG - Intergenic
971362974 4:25953803-25953825 ACTTCTCTTTAGAGACAGCAGGG - Intergenic
971846659 4:31927460-31927482 AATTCTCTTCAGGGGAACCAAGG + Intergenic
972708787 4:41572884-41572906 ACTGCTATTCAGTGACATCACGG + Intronic
973001941 4:44962064-44962086 ACTTGCATTCAGGGCCAGCTTGG - Intergenic
973932499 4:55807111-55807133 ACATCGCTTCAGGGTCAGCAAGG + Intergenic
983036966 4:162878654-162878676 ACTTCTATTGAGGCCCAGCGTGG + Intergenic
983719678 4:170833953-170833975 CCTTTAATTCAGAGGCAGCAAGG + Intergenic
984597075 4:181682302-181682324 TCTTCTGTTCAGTGACAGCAGGG + Intergenic
986220258 5:5762721-5762743 ACCTCTATTCCTGGGGAGCAGGG - Intergenic
986551562 5:8961704-8961726 GCTTCTATTCAGGATCAGCGTGG + Intergenic
988877660 5:35465529-35465551 ACTTGTATTAAGGGGCAGCCTGG + Intergenic
990917610 5:60927744-60927766 CCTTCTATTCAAGGACAGCTGGG - Intronic
992645881 5:78810209-78810231 CCTGCTATTCAGGGGCATCAGGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
999787442 5:154904577-154904599 GCTTGTACTCAGGGGAAGCAAGG + Exonic
1001911588 5:175523222-175523244 ATTTCTATTCAAGAACAGCAGGG - Intronic
1001929326 5:175661553-175661575 ACTCCTAATCAGGGTCAGGAAGG + Intronic
1008005037 6:46401578-46401600 ACTGAAATTGAGGGGCAGCATGG - Intronic
1009383892 6:63066422-63066444 ACTTCAATGCAGTTGCAGCAGGG + Intergenic
1014533500 6:122588877-122588899 ACTTCTAATCAGCAGCAGAAAGG + Intronic
1022139052 7:27476288-27476310 AATTCTGCTCAGGGGCATCAGGG - Intergenic
1026217173 7:68359891-68359913 TCTTCTATTCAGGGCCTCCATGG - Intergenic
1028672556 7:93420009-93420031 AATTCTATTTAGGGCCAGCGCGG + Intergenic
1031416157 7:121498681-121498703 AGTTCTCTCAAGGGGCAGCATGG + Intergenic
1032871982 7:135995807-135995829 ACCTCTATTCAGATGCATCAAGG + Intergenic
1035068690 7:156125527-156125549 ACTTCTACTGTTGGGCAGCACGG - Intergenic
1036195042 8:6707226-6707248 AGTTCTAATCAGGGCCAGGATGG - Intergenic
1037656324 8:20887305-20887327 GCTTCTACTCAGGGACACCAAGG + Intergenic
1039599746 8:38825507-38825529 CCTTCTCTTCAGGGACAGTAAGG - Intronic
1041159046 8:55018547-55018569 ACCACCACTCAGGGGCAGCAAGG + Intergenic
1043940649 8:86191896-86191918 GCTCCTATCCAGGGGCACCAAGG - Intergenic
1044947143 8:97399880-97399902 CCTTCTTTTCATGGCCAGCAGGG - Intergenic
1047308961 8:123676409-123676431 ACTTCTTTACATGGGCAGCCAGG - Intergenic
1048005697 8:130417761-130417783 ATTTCTGTTCAGGGGAAGGATGG + Intronic
1048826721 8:138434923-138434945 ACTTGTATTCAGTAGCAGGAGGG - Intronic
1050158307 9:2691262-2691284 ACCTCTAATCAACGGCAGCAAGG + Intergenic
1050265647 9:3886886-3886908 CCTTCTACTCATTGGCAGCAAGG - Intronic
1051853495 9:21536243-21536265 ACTTCCCGTCAGGGCCAGCAAGG + Intergenic
1058033300 9:100223677-100223699 AGTTCTATTTAGGGTCATCAAGG + Intronic
1186045444 X:5532064-5532086 CCTTCTCTTCAGTGGCAGCGTGG - Intergenic
1187478778 X:19635771-19635793 ACTTCCATGCAGGGACAGGAGGG - Intronic
1187726290 X:22205959-22205981 ACTTTTATTGGGGGTCAGCAGGG + Intronic
1189059617 X:37738625-37738647 AGTTCTACACAGGGGCACCATGG + Intronic
1191893501 X:65968990-65969012 ACTTCTCTACATGGGTAGCATGG + Intergenic
1192133334 X:68573648-68573670 ACTTTGATTCAGTGGCAGGATGG + Intergenic
1194628333 X:96252084-96252106 AATTCTATTCAGGAGCAGAAAGG - Intergenic
1196370198 X:114969088-114969110 ACTTCTCTTCAGTGCCACCATGG - Intergenic
1200088296 X:153622256-153622278 ACATCTATAAAGGGGTAGCACGG + Intergenic
1201540169 Y:15097273-15097295 TCTTCTCTTCAGTGTCAGCATGG + Intergenic