ID: 902070721

View in Genome Browser
Species Human (GRCh38)
Location 1:13733706-13733728
Sequence GAATTCCTACGCAATACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 24}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902070721_902070722 17 Left 902070721 1:13733706-13733728 CCTGGGGTATTGCGTAGGAATTC 0: 1
1: 0
2: 0
3: 6
4: 24
Right 902070722 1:13733746-13733768 TAGTTCAAGTCAGTGCCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902070721 Original CRISPR GAATTCCTACGCAATACCCC AGG (reversed) Intronic
901359672 1:8686313-8686335 GAATTTCTACGTAATTCCCTAGG - Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
904946102 1:34199869-34199891 GCCTTCCTCCCCAATACCCCTGG + Intronic
905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG + Exonic
907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG + Intronic
1070659755 10:78296087-78296109 GAATTCCAAAACAATCCCCCTGG - Intergenic
1080454865 11:32408948-32408970 GAATTCCTAGGGAATACTCCTGG - Intronic
1089355421 11:117848104-117848126 GAATTCCTACCCAGTACACTAGG - Intronic
1092799883 12:12153963-12153985 CAGTTCCTACTCAATGCCCCTGG - Intronic
1096585001 12:52614253-52614275 GGATTCCTGCCCAAGACCCCAGG + Intronic
1109482088 13:62969123-62969145 GACTTACTACGCTCTACCCCAGG + Intergenic
1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG + Intergenic
1112992640 13:105532852-105532874 GAAGTCCTCAGCAATACCCTGGG + Intergenic
1137559596 16:49494173-49494195 GAATGCCTATGCCATTCCCCAGG + Intronic
1141035260 16:80620715-80620737 GTAATCCTACGCAGGACCCCAGG + Intronic
933422617 2:82069882-82069904 GAATTGCTACACAATAACCCTGG + Intergenic
934916157 2:98302690-98302712 GAATGCCTACTCAACACACCAGG - Intronic
937805267 2:126134381-126134403 GAAATCCTAATCAATAACCCAGG + Intergenic
946042686 2:216795981-216796003 GAATCCCTACCCAAAACCCCAGG - Intergenic
955407805 3:58636359-58636381 GAGTTCCTACGCAAAACAACTGG - Exonic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
984712293 4:182895858-182895880 GAATTTGTAAGCAATTCCCCGGG + Intronic
991035311 5:62122427-62122449 GATTTCCCACACAATACCCCCGG - Intergenic
1004545453 6:16594270-16594292 CCATTCCTAGGCAATAACCCAGG - Intronic
1009540791 6:64955660-64955682 GAATGCCTAAGCAAAACCCATGG - Intronic
1010841093 6:80649921-80649943 GAATTCTTACACAAGAGCCCAGG - Intergenic
1037722403 8:21456027-21456049 GGATTCCTAGGCACTACCCAAGG + Intergenic
1053036848 9:34833343-34833365 CAATTCCAAAGCAGTACCCCAGG - Intergenic
1060671767 9:125476057-125476079 GAATTCCTATGGAGTAACCCAGG - Intronic
1189490667 X:41469313-41469335 GAATTCCTAGCAAATACCCCTGG - Intronic
1201537246 Y:15064184-15064206 GAAAACCTAGGCAATACCACTGG - Intergenic