ID: 902070722

View in Genome Browser
Species Human (GRCh38)
Location 1:13733746-13733768
Sequence TAGTTCAAGTCAGTGCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902070720_902070722 18 Left 902070720 1:13733705-13733727 CCCTGGGGTATTGCGTAGGAATT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 902070722 1:13733746-13733768 TAGTTCAAGTCAGTGCCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 76
902070721_902070722 17 Left 902070721 1:13733706-13733728 CCTGGGGTATTGCGTAGGAATTC 0: 1
1: 0
2: 0
3: 6
4: 24
Right 902070722 1:13733746-13733768 TAGTTCAAGTCAGTGCCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902070722 Original CRISPR TAGTTCAAGTCAGTGCCCCC TGG Intronic
902070722 1:13733746-13733768 TAGTTCAAGTCAGTGCCCCCTGG + Intronic
902434004 1:16385382-16385404 TAGTTCGAATCAGTCCCCCAGGG + Intronic
904584570 1:31573042-31573064 GAGCTCAGGTCAGTGCTCCCTGG - Intergenic
908070291 1:60453033-60453055 TAGTTGAAGAAAGTGCACCCTGG - Intergenic
908799579 1:67865447-67865469 TAAATCAAGTCAGTGCCTTCTGG - Intergenic
915684233 1:157615548-157615570 TAGTGCATCTCAGTGTCCCCTGG + Intergenic
915685784 1:157631818-157631840 TACTTGAAGTCAGTGTCCCATGG + Intergenic
915825356 1:159070048-159070070 TAGTGCAAGTCACTTCCCCATGG + Intronic
921959969 1:221024384-221024406 TAGCTCATATCAGTGCTCCCTGG + Intergenic
1063617293 10:7611495-7611517 TAGTCCAATCCAGTGCCCCAGGG - Intronic
1064314308 10:14240511-14240533 TAGTTCAATTCAGTGGCTACGGG + Intronic
1065360512 10:24884988-24885010 GAGTTGAAGACAGGGCCCCCAGG - Intronic
1066031541 10:31431291-31431313 TAGTTTAAGGCAATGCTCCCTGG - Intronic
1068758170 10:60679101-60679123 TTGTTCAGATCATTGCCCCCCGG - Intronic
1075708441 10:124517264-124517286 AAGTTCAGGTCAGTGCCAGCTGG + Exonic
1076813222 10:132899725-132899747 CAGTTCAAGACAGTGACCCAGGG - Intronic
1081281216 11:41211098-41211120 CAGTACAAGTCTGTGGCCCCAGG + Intronic
1081486212 11:43531599-43531621 AAGTTCAAGTCCTAGCCCCCAGG + Intergenic
1083280903 11:61626882-61626904 TAGTTCAAGTCAGGTGCCCCTGG + Intergenic
1084429222 11:69102015-69102037 TGGGCCACGTCAGTGCCCCCGGG + Intergenic
1090394943 11:126412718-126412740 TAGTGCATGTCAGAGCACCCAGG + Intronic
1096026514 12:48368807-48368829 TAGTTGACCTCAGTGGCCCCAGG + Intergenic
1099993578 12:89752919-89752941 GAGTGCAGGTCAGTGCCCACAGG - Intergenic
1100092775 12:90991955-90991977 TTTTTGAAGTCTGTGCCCCCAGG - Intronic
1106389882 13:29324735-29324757 AAGTTCAAGTCATTCCCCCAAGG - Intronic
1107341435 13:39411132-39411154 TAGAGCAACTCACTGCCCCCAGG - Intronic
1112875949 13:104038964-104038986 AAGTTCTAGCCAGTGCCACCAGG + Intergenic
1114387060 14:22266340-22266362 GAGTTATAGTCAGTGCCCCAGGG - Intergenic
1119674497 14:76543863-76543885 TTGTGCAAGGCAGTGGCCCCAGG + Intergenic
1121274355 14:92657650-92657672 AAGTTCAAGTCCCTGCTCCCAGG + Intronic
1125542510 15:40478241-40478263 GAGTTTAATTCAGTACCCCCAGG - Intergenic
1130967642 15:88709073-88709095 TTGTTCAAGTCAGTTGCCCAGGG - Intergenic
1152360476 17:79831043-79831065 TTGTTCAATTCAGTCCCCACAGG - Intergenic
1154093569 18:11388124-11388146 CAGTTCATGTTAGTGCCTCCAGG - Intergenic
1155503332 18:26508414-26508436 TTGTTCAAGGCAGTACCCCCAGG - Intronic
1157571007 18:48712221-48712243 TAGTTTAAGTGGGTTCCCCCAGG - Intronic
1158330406 18:56356310-56356332 TATTTGAAGTTAGTGCCCACAGG - Intergenic
1160211539 18:76884616-76884638 AAGTTCACGGCAGTGACCCCAGG - Intronic
1161376153 19:3940003-3940025 TAATTCAAGACAGGGCCCTCAGG - Intronic
1167069308 19:47210772-47210794 TAGTGCAAGTCAGTGGCGTCAGG + Intergenic
1167838364 19:52094139-52094161 TGGATCAAGTCACTGCCCTCTGG + Intronic
929021282 2:37555725-37555747 AAGTTTTAGTCAGTGCCCTCAGG - Intergenic
934986261 2:98887826-98887848 TAGTTCATCTCAGTGCCTTCTGG - Intronic
935089252 2:99878559-99878581 AAATACAAGTCAGTGCCTCCTGG - Intronic
935395354 2:102602476-102602498 AACTTCAAGACAGTGCCTCCTGG - Intergenic
935744948 2:106182313-106182335 TTGTTCAAGCCACTGCCCGCGGG - Intronic
944135948 2:196399347-196399369 GACTTCAAGTCATTTCCCCCTGG + Intronic
944161236 2:196662632-196662654 TAGTACCAGTCTGTGGCCCCAGG + Intronic
1169114106 20:3051838-3051860 CACTACCAGTCAGTGCCCCCAGG + Intergenic
1169936875 20:10893255-10893277 AAGTTCAAGTCAAGGCCCACCGG - Intergenic
1170785250 20:19462165-19462187 TAGTTCCCCTCAGAGCCCCCTGG + Intronic
1173159213 20:40639858-40639880 TGGCTCAATTCAGTGCTCCCTGG + Intergenic
1185332412 22:50257707-50257729 GAGGTCAAGTCAGTGGCCTCTGG - Intronic
950689410 3:14643746-14643768 TCCTTCAAGTCACTGTCCCCAGG + Intergenic
952149850 3:30577597-30577619 AAGAGCAAGTCAGTGCCACCTGG - Intergenic
952605730 3:35145280-35145302 TAATTCAACTCAGTTCCACCTGG + Intergenic
956608869 3:71101471-71101493 TTCTTCAAATCAGTACCCCCTGG - Intronic
959181672 3:102987862-102987884 TAGTACCAGTCAGTGACCCAGGG + Intergenic
970505972 4:16730940-16730962 GAGTTCAAGTTACTTCCCCCAGG + Intronic
974652960 4:64778638-64778660 GAGTTCAAGACAGAGACCCCAGG + Intergenic
988524657 5:31976635-31976657 TAGTACAAGCCAGTGCCCAGTGG + Intronic
991568805 5:68033315-68033337 TAGAGGAAGTCCGTGCCCCCAGG - Intergenic
995669549 5:114586308-114586330 TAGTGCATGTCTGTGGCCCCAGG - Intergenic
999795827 5:154988992-154989014 TCGTTCAAGGCTGTGCTCCCAGG - Intergenic
1004477757 6:15989583-15989605 TAGTTCCACTCAGAGCCCCAAGG - Intergenic
1010688521 6:78879745-78879767 TAGTACATGTCAGTCCCCCATGG + Intronic
1011543527 6:88459420-88459442 TAGCTCAAGATATTGCCCCCTGG + Intergenic
1011667984 6:89654114-89654136 TACTTCAAGTCAGAGCGCCTGGG + Intronic
1018021659 6:159766871-159766893 CAGGTCAAGTAAGTGCCCACTGG - Intronic
1018784293 6:167096074-167096096 CAGTTCCAGTCTGTGCCACCAGG + Intergenic
1022636073 7:32136747-32136769 TAGCTCAATTCTTTGCCCCCAGG + Intronic
1025731926 7:64115012-64115034 TACTTCAGGTGAGTGCCCCCTGG + Intronic
1034909708 7:154985652-154985674 AATTTCAAGTCTGTGCCCCCAGG + Intronic
1034935648 7:155198800-155198822 TTGTTCAATTCAGTGACCGCCGG - Intergenic
1036909134 8:12738535-12738557 TAGTTCACATAAGTGCCCCAAGG - Intronic
1039600604 8:38833826-38833848 TAGTTTAAGCCAGAGTCCCCAGG - Intronic
1040754599 8:50757454-50757476 TTGTTGAAGTCTGTGCCACCTGG + Intronic
1043428791 8:80174548-80174570 TGGTTCAACTCAATGCACCCAGG - Intronic
1046635691 8:116673101-116673123 TAGTGCAAGCCATTGCCTCCTGG - Intronic
1058549056 9:106093730-106093752 TAGTTTCATGCAGTGCCCCCAGG + Intergenic
1188593854 X:31872451-31872473 TTGTCCCAGTCTGTGCCCCCCGG - Intronic