ID: 902070855

View in Genome Browser
Species Human (GRCh38)
Location 1:13735652-13735674
Sequence TAGGATGTTGATAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 992
Summary {0: 1, 1: 9, 2: 49, 3: 202, 4: 731}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902070855_902070861 -10 Left 902070855 1:13735652-13735674 CCTTCCCCATTATCAACATCCTA 0: 1
1: 9
2: 49
3: 202
4: 731
Right 902070861 1:13735665-13735687 CAACATCCTACAGCAGAGCGGGG 0: 1
1: 0
2: 2
3: 7
4: 106
902070855_902070863 -4 Left 902070855 1:13735652-13735674 CCTTCCCCATTATCAACATCCTA 0: 1
1: 9
2: 49
3: 202
4: 731
Right 902070863 1:13735671-13735693 CCTACAGCAGAGCGGGGCATTGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902070855 Original CRISPR TAGGATGTTGATAATGGGGA AGG (reversed) Intronic
900079681 1:846505-846527 GGGGATGTTGATAATGGGGGAGG + Intergenic
900578578 1:3396260-3396282 TAGGATATTCATAAAGGGGGTGG - Intronic
900742084 1:4336624-4336646 GATGATGTTGATGATGGTGATGG + Intergenic
900812017 1:4811420-4811442 GATGATATTGATAATGGGGGAGG + Intergenic
901127063 1:6937047-6937069 TATGATGGTGATAATGGTGACGG - Intronic
901218471 1:7568111-7568133 CATGATGATGATAATGGAGATGG - Intronic
901274336 1:7979339-7979361 CAGGATGTTGATAGTAGGGGAGG - Intronic
902070855 1:13735652-13735674 TAGGATGTTGATAATGGGGAAGG - Intronic
902424928 1:16312726-16312748 GGGGATGTTGATAATGGGAGAGG + Intronic
902798740 1:18816424-18816446 GATGATGTTGATGATGGTGATGG - Intergenic
902800281 1:18825291-18825313 GATGATGTTGGTAATGGTGATGG - Intergenic
902800322 1:18825557-18825579 GATGATGTTGGTAATGGTGATGG - Intergenic
902957076 1:19932960-19932982 TATGATGGTGATAATGGTGATGG - Intergenic
902988051 1:20167527-20167549 CAGCATGGTGACAATGGGGATGG - Intronic
902995740 1:20223419-20223441 TAGGGTGCTGATGGTGGGGATGG - Intergenic
903704299 1:25273746-25273768 TAGGTTGTTGATAATAGACAGGG + Intronic
903722939 1:25419571-25419593 TAGGTTGTTGATAATGGACAGGG - Intronic
904008100 1:27374310-27374332 TGGGATCTTGGGAATGGGGAAGG - Intronic
906133197 1:43474620-43474642 TAAGATGTTAATAACGGGAAAGG + Intergenic
906522277 1:46474671-46474693 GATGGTGTTGATAATAGGGATGG - Intergenic
906596684 1:47083825-47083847 TAGGTAGGTGATAATGGGGGTGG - Intronic
906907122 1:49907864-49907886 GAGGATGTTGATAATTGGAGAGG + Intronic
907026209 1:51122527-51122549 TAGGATGTGGATAGTTGGGGAGG - Intronic
907095093 1:51771023-51771045 TGGGATGTTGATCATGAGGGAGG + Intronic
907142267 1:52198824-52198846 GAGGATATTGATAATGGCGGAGG - Intronic
907645770 1:56241926-56241948 ACAGATGTTGATAATGGGGGAGG + Intergenic
907743819 1:57192564-57192586 AAGGATGTTGCTGATGGTGATGG - Intronic
907809790 1:57857420-57857442 GATGATGGTGATGATGGGGATGG + Intronic
907882173 1:58560856-58560878 AAGGCTGTTGATAACGGGGGAGG + Intergenic
908238107 1:62166799-62166821 GAGGATGTTGATAATGGGAGAGG - Intergenic
908279233 1:62513032-62513054 GGGGATGTTAATAATGGGGGAGG + Intronic
908562594 1:65321611-65321633 GGGGATGTTGATAATGGGAGAGG - Intronic
908674771 1:66591535-66591557 GGGGATGTTGATAATGGGGGAGG - Intronic
908843852 1:68304857-68304879 TAGGATGAAGATAATGGTGGAGG - Intergenic
908917294 1:69143483-69143505 GGGGATGTTGATAATGGGGAAGG + Intergenic
909102538 1:71367487-71367509 CAAGATGTTGGTGATGGGGAAGG - Intergenic
909143743 1:71900933-71900955 TAGTATGATGATGATGGCGATGG - Intronic
909186321 1:72491081-72491103 AGGGATGTTGATAATGGAGGAGG + Intergenic
909471088 1:76028898-76028920 GAGGATGTTGGTAATGGGTGAGG + Intergenic
909510361 1:76446265-76446287 ATGGATGTTGATAATGGGGGAGG - Intronic
909664125 1:78114858-78114880 TTGGAGGTTGATAATGGGAGAGG + Intronic
910124274 1:83823103-83823125 TAGGATGTTGATTGAGGGGGAGG + Intergenic
910136121 1:83972043-83972065 GTGGATGTTGATAATGGGGGAGG - Intronic
910224283 1:84920351-84920373 TGGGATGTTGATAATGGCAGAGG + Intergenic
910372556 1:86532065-86532087 AGGGATGTTGATAACGGGGAAGG - Intergenic
910576447 1:88770454-88770476 TTGGCTTTTGATAATGGTGATGG + Exonic
910663506 1:89699435-89699457 GAGCTTGGTGATAATGGGGAGGG + Intronic
910767946 1:90801289-90801311 TGGGATGTTGAGAATGGGGGAGG - Intergenic
910804035 1:91172944-91172966 AGGAATGTTGATAATGGGGGAGG + Intergenic
910997525 1:93123874-93123896 AGGGATGTTGATAATGGAGGAGG - Intronic
911078355 1:93902596-93902618 GGGTATGTTGATAATGGGGGAGG - Intronic
911172926 1:94789187-94789209 GAGGATGTAGAGAAAGGGGAAGG + Intergenic
911388276 1:97205090-97205112 CAAGATATTAATAATGGGGAAGG - Intronic
911648108 1:100356912-100356934 TAGGATGGTGACAATGGTGATGG + Intronic
911809607 1:102258599-102258621 GAGGATGTTGATAATGGTGGAGG + Intergenic
911813745 1:102315828-102315850 AGGGAGGTTGATAATGGGGAAGG + Intergenic
911868836 1:103065103-103065125 TGGGATATTGATAATAGGGAAGG + Intronic
912010916 1:104961201-104961223 GAGGATGTTGATAATGGGGAAGG + Intergenic
912017991 1:105066127-105066149 CAAGATGTTGAGAAAGGGGAAGG - Intergenic
912136944 1:106672310-106672332 AAAGATGTTGATAATGGGGAAGG + Intergenic
912306427 1:108572350-108572372 CAGGATGTTGCTAGTGGGGGAGG - Intronic
912854478 1:113154843-113154865 CAGAATGTTGATAGTGGGGGAGG - Intergenic
912970844 1:114281593-114281615 GGGGATGTTGATAATGGGGGAGG + Intergenic
913060201 1:115197581-115197603 TGGGATGGTGATCATAGGGATGG - Intergenic
913068769 1:115281450-115281472 TAGGCTGTGGATGGTGGGGATGG + Intergenic
913235476 1:116777469-116777491 GGGGATGTTGATAATGGGGAAGG + Intergenic
913294213 1:117303248-117303270 CAGGATGTTGATGATGGGAGAGG - Intergenic
913507466 1:119530849-119530871 GAGGGTGTTGATAGTGGGGGAGG + Intergenic
913571132 1:120121024-120121046 GGGGATGTTGATAATGGAGAGGG - Intergenic
914243144 1:145866119-145866141 GAGGATATTGATAATTGGGGAGG + Intergenic
914291942 1:146282002-146282024 GGGGATGTTGATAATGGAGAGGG - Intergenic
914552986 1:148732785-148732807 GGGGATGTTGATAATGGAGAGGG - Intergenic
916938080 1:169651433-169651455 GCAGATGTTGATAATGGGGGAGG + Intergenic
917063144 1:171062895-171062917 GGGGATGTCGATAATGGGGGAGG - Intronic
917587314 1:176440649-176440671 TAGAATGTTGATGGTGGTGATGG - Intergenic
918321779 1:183371524-183371546 GGGGATGTTGATAATGGGCAAGG + Intronic
918557618 1:185822267-185822289 GGGGATGTTGATAATGGCGGAGG + Intronic
918833936 1:189435285-189435307 AGGGATGTTGATAATGGAGAAGG + Intergenic
918979733 1:191540647-191540669 GGGGATGTTGATAATGGGAGAGG - Intergenic
919306944 1:195854032-195854054 AAGGATGTTGACAATGGAGGAGG + Intergenic
920162217 1:204007737-204007759 TGGGATGTTAATAATGGGGGAGG + Intergenic
920606649 1:207395263-207395285 GAGAATGTTGATAATAAGGAAGG + Intergenic
920945813 1:210527510-210527532 TATGATGCTGATAATGGTGATGG - Intronic
921279510 1:213551636-213551658 CTGGATGTTGATAGTGGGGGAGG - Intergenic
921536813 1:216360599-216360621 AGGGATATTGACAATGGGGAAGG + Intronic
921658038 1:217764004-217764026 CAGGATGTTGACAGTGGGGAAGG - Intronic
921790858 1:219288715-219288737 GGAGATGTTGACAATGGGGAAGG + Intergenic
921914776 1:220595062-220595084 TGGGATGTTGATGGTGGGGGAGG + Intronic
922272635 1:224048241-224048263 GGGAATGTTGACAATGGGGAAGG + Intergenic
922318297 1:224462097-224462119 GCGGATGGTGATAATGGGGGAGG - Intronic
922496237 1:226060477-226060499 TAGAGTCTAGATAATGGGGAAGG - Intergenic
922876646 1:228944772-228944794 TATGATCTTGGTAATTGGGAGGG - Intergenic
923106892 1:230861249-230861271 TAGGATGTTGGTGGTGGGAAAGG + Intronic
923242383 1:232098419-232098441 TGAGATGTTGATAATGGGAGAGG + Intergenic
923252379 1:232189550-232189572 GAGGATGTTGATAGTAGCGAAGG + Intergenic
923514109 1:234680280-234680302 TGGGATGTTGACAGTGGGGGAGG + Intergenic
923549583 1:234952766-234952788 GGGGATGTTGACAGTGGGGAAGG - Intergenic
923624974 1:235606500-235606522 TAGGATCTGGATGCTGGGGAGGG + Intronic
923717681 1:236438775-236438797 CAGGATGCTGACAATGGGGGTGG - Intronic
924124500 1:240836151-240836173 TGGGGGGTTGATAATGGGGGCGG + Intronic
924167517 1:241300208-241300230 CAGGGTGTTGATAGTGGGGTAGG - Intronic
924649417 1:245911227-245911249 AAGGATGTGGAGAAAGGGGAAGG + Intronic
1062778332 10:175163-175185 TGGGATGTTGATAATAGGGGAGG + Intronic
1063606447 10:7526851-7526873 TGGGATGTATATAATGTGGAGGG + Intergenic
1063631056 10:7734269-7734291 ATGGATGTTGATAGTGGGGAAGG + Intronic
1063644330 10:7864019-7864041 TAGGATACTGACAGTGGGGAAGG - Intronic
1063650987 10:7936612-7936634 GGGGATGTTGATAGTGGGGGAGG - Intronic
1063818248 10:9802511-9802533 TATGATATTGAGTATGGGGAAGG - Intergenic
1064505289 10:16022809-16022831 TGGGATGTTGGTCATGGGGGAGG - Intergenic
1065244942 10:23747394-23747416 TATGAAGATGATAATGGGGTGGG + Intronic
1065469075 10:26057916-26057938 TGGGATGTTGACAGTGGAGAAGG - Intronic
1065818643 10:29505737-29505759 GGGGATGTTGATAATTGGGGTGG + Intronic
1065954277 10:30678659-30678681 GGGGATGTTGATAATTGGGGTGG - Intergenic
1065979901 10:30883399-30883421 GAGGATGATGATAATGATGATGG - Intronic
1066006815 10:31153544-31153566 TAGGCAGTTGATATTGGGGATGG + Intergenic
1066216502 10:33293376-33293398 TTGCATCTTTATAATGGGGATGG + Intronic
1067397457 10:45935439-45935461 GGGGATGTTGATAATGGGGGAGG + Intergenic
1067529164 10:47057999-47058021 GGAGATGTTGATAATGGGGGAGG + Intergenic
1067761465 10:49050982-49051004 CAGGATGTTGATCATGGGGGAGG - Intronic
1067790038 10:49281127-49281149 AGGAATGTTGCTAATGGGGAAGG - Intergenic
1067865775 10:49904525-49904547 GGGGATGTTGATAATGGGGGAGG + Intronic
1068590921 10:58852228-58852250 AGGGATATTGATAATGGGGGAGG + Intergenic
1069022729 10:63506700-63506722 TGGGATGTTGATATTGGAGGAGG - Intergenic
1069107296 10:64398568-64398590 GAGGATGTTGATAATGGGGGAGG - Intergenic
1069149136 10:64933732-64933754 GGGGATGTTGATAATGTGGGAGG - Intergenic
1069240114 10:66128839-66128861 GAGGATGTTGATAACGGGAAAGG + Intronic
1069691015 10:70352635-70352657 GGGGATGTTGATCATGGAGAAGG + Intronic
1069796546 10:71056297-71056319 TGGGATTTTGATGGTGGGGAAGG + Intergenic
1070412871 10:76160085-76160107 GGGGATGTTGATAAGGGGGGAGG + Intronic
1071049705 10:81431395-81431417 CAAGATGTTGATAGTGGGGGAGG - Intergenic
1071104561 10:82079434-82079456 GAGGATATTGATAATGTGGAAGG - Intronic
1071262021 10:83928963-83928985 TAGGATAATGGGAATGGGGATGG - Intergenic
1071534770 10:86419338-86419360 CAGGATGTTGATCATGGGGGAGG + Intergenic
1072716851 10:97757855-97757877 CAGGATTTTGCTAAAGGGGATGG - Intronic
1072976794 10:100065811-100065833 TGGGATGTTGATGGTGGGGTGGG + Intronic
1073638512 10:105224016-105224038 GAGGATGTTGATAATGGAGGAGG - Intronic
1074146620 10:110722349-110722371 GGGGATGCTGATAATGGGGGAGG - Intronic
1074374856 10:112931940-112931962 CAGGATGTTGATAGTGGGAGAGG + Intergenic
1074562937 10:114550486-114550508 GGGGATGTTGCTAATGGGGGAGG - Intronic
1074589238 10:114796999-114797021 TAGGATGTTGATGTGGAGGATGG - Intergenic
1074918154 10:117979165-117979187 CAGAATGTTGATAGTGGGGTAGG + Intergenic
1075447438 10:122523498-122523520 AGGGATGTTGATAATGGGGGCGG + Intergenic
1075501402 10:122978519-122978541 AAGGATGTTGATAGTGGGGGAGG + Intronic
1076082092 10:127591443-127591465 GAGGATGTTGATAATGGGGAGGG + Intergenic
1077920315 11:6637095-6637117 CAGAATGGTGATAATGGTGATGG - Intronic
1077927725 11:6698575-6698597 TAGGTTGTGGAAAATGGAGAGGG + Intergenic
1079123468 11:17701526-17701548 CAGGATGTTGACAGTGGGGGAGG - Intergenic
1079631229 11:22678240-22678262 TAGAATGGTGATAATAAGGAGGG + Intronic
1079813015 11:25019021-25019043 TAAAATGTTGATAATGTGGGAGG - Intronic
1079953477 11:26833488-26833510 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1080065353 11:28005222-28005244 TAGAATGTTTATCCTGGGGAAGG - Intergenic
1080339618 11:31246052-31246074 TAGGATGTTGCTTTTGGAGAGGG - Intronic
1080798429 11:35587514-35587536 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1081349488 11:42032462-42032484 GAGGATGTTGCTAATGAAGAAGG + Intergenic
1081459542 11:43259222-43259244 GGGGATGTTGATAATGGGAGAGG + Intergenic
1081578574 11:44335092-44335114 TATCATTTTGGTAATGGGGAAGG + Intergenic
1082192326 11:49261592-49261614 GGGGATGTTGATAATTGGGGAGG - Intergenic
1082635721 11:55591009-55591031 AAGGATGTTGATAATGGAGAAGG - Intergenic
1083073625 11:60014026-60014048 GGGGGTGTTGATAATGAGGAAGG - Intergenic
1084346072 11:68549795-68549817 TAGGAGGTTGATAAAGGTGTAGG + Intronic
1084696956 11:70761495-70761517 TGGGATGATGATGATGGTGAAGG + Intronic
1084924194 11:72498835-72498857 GGGGATGTTGATAATGGGGGAGG - Intergenic
1085274148 11:75287481-75287503 TAGGATTTTGATAAGGGTTAGGG - Intronic
1085429360 11:76433754-76433776 CAGGATGTTGATAGTGAGGGAGG - Intergenic
1086090489 11:83000009-83000031 TGAGATGATGATGATGGGGAGGG - Intronic
1086150500 11:83604709-83604731 TGGAATTTTGATAATGGGGGTGG + Intronic
1086326391 11:85705513-85705535 TGGGATGTTGATAGTGGGGGAGG - Intronic
1086478247 11:87203136-87203158 CGGGATGTTAATAATGGGGGAGG - Intronic
1086537996 11:87872383-87872405 CAGGATGTTGATGGTGGGGGAGG - Intergenic
1086663159 11:89446936-89446958 GGGGATGTTGATAATGGGGGAGG + Intronic
1086673799 11:89579367-89579389 GGGGATGTTGATAATTGGGGAGG + Intergenic
1087803806 11:102533892-102533914 AGGGATGTTGATAATGGGGGAGG + Intergenic
1087955529 11:104282231-104282253 GAGGATGTTGATAATGGAGGAGG - Intergenic
1087987554 11:104703460-104703482 GGGGATATTGATAATGGGAAAGG - Intergenic
1088911925 11:114198678-114198700 TGGGATGTTGATGGTGGGGGAGG - Intronic
1088991625 11:114958903-114958925 GAGGATGTTGATAGTGGGGAAGG + Intergenic
1089036719 11:115401858-115401880 GAGGATGTTGACAACAGGGAAGG + Intronic
1089095796 11:115918969-115918991 TAGGAATTTGATAATGGGAAGGG + Intergenic
1089377008 11:118001533-118001555 TCGGTTGTTGATAATGAGGAGGG + Intergenic
1089576225 11:119446295-119446317 GGGGATGTTGATGATGGGGGAGG + Intergenic
1089831618 11:121333846-121333868 TGGGATGTGGATAGTGGGGGAGG + Intergenic
1090168283 11:124575518-124575540 AGGGGTGTTGATACTGGGGAAGG + Intergenic
1090306029 11:125692107-125692129 CAGGATGTTAATATTGGGGGAGG + Intergenic
1090748668 11:129727362-129727384 TAGGGTGTTGCTGATGGTGAAGG - Intergenic
1090847251 11:130540615-130540637 AGGGATGCTGATAGTGGGGAAGG - Intergenic
1091426044 12:390203-390225 TAGGATACTGGTAACGGGGATGG - Intronic
1091454462 12:596429-596451 GGGGATGTTGATAATGGGGGCGG + Intronic
1091464607 12:673080-673102 TGGGATGTTGACAGTGGGGGAGG - Intergenic
1091493691 12:953802-953824 TATGATGTTCACAGTGGGGAAGG - Intronic
1091599705 12:1910449-1910471 CAGGATGTTGATAGCGGGGAAGG + Intronic
1091668742 12:2437728-2437750 TTGGATGGTGGTAATGGGGATGG + Intronic
1092192375 12:6530291-6530313 CAGGATGTTGAAGGTGGGGAAGG - Intronic
1092278887 12:7084950-7084972 GATGATGTTGGTAATGGTGATGG + Intronic
1092278946 12:7085336-7085358 GATGATGTTGGTAATGGTGATGG + Intronic
1092908739 12:13126091-13126113 TGGGATGCTGATAATGAGGCTGG - Intronic
1093112291 12:15166486-15166508 GATGATGATGATGATGGGGATGG + Intronic
1093176907 12:15922890-15922912 GGGGATGTTGATAATGGGGGAGG + Intronic
1093296418 12:17397423-17397445 TGGGATGTCGATAGTGGGGGAGG + Intergenic
1093591620 12:20908311-20908333 GGAGATGTTGATAATGGGGAAGG - Intronic
1093738135 12:22648152-22648174 TCTGATATTGATAATGGGGGAGG - Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1094215341 12:27935021-27935043 GGGGATGTTGATAATGGGGAAGG + Intergenic
1094812988 12:34159948-34159970 TAGGATGTGGATCCAGGGGATGG + Intergenic
1095256205 12:40039744-40039766 GAAGATGTTGATAATTGGGGAGG - Intronic
1095376613 12:41536639-41536661 GAGGATGTTGATAATAGAAAAGG + Intronic
1095582283 12:43814016-43814038 TTAGATGTTTATAATGGAGATGG + Intergenic
1095681349 12:44980139-44980161 GGGGATGTTGATACTGGGGGAGG - Intergenic
1096097983 12:48949892-48949914 TTGGATGTTGATGATGTAGAAGG + Intronic
1096149707 12:49301187-49301209 TAAGATGTTGGTAATGGGGATGG - Intergenic
1097256515 12:57679914-57679936 CAGGATGTTGACAGTGGGGGAGG + Intergenic
1097407778 12:59212006-59212028 CTGGATGTTGATAGTGGGGAAGG - Intergenic
1097437159 12:59563964-59563986 GAAGCTGTTGATAATGGGGGAGG + Intergenic
1097497026 12:60352727-60352749 GAGGATGTTGATAATGAAGGAGG - Intergenic
1098069356 12:66655410-66655432 TGGGATGTTGATAGTGGGGGAGG - Intronic
1098656392 12:73035689-73035711 GAGGATGTTGATACTGGGGGAGG - Intergenic
1098690560 12:73482143-73482165 TCAGATGTTGATAAAGGGTATGG - Intergenic
1099017312 12:77359346-77359368 GAGGATGTTGATGATGAGGCAGG - Intergenic
1099151876 12:79124569-79124591 GATGATGATGATAATGGTGATGG - Intronic
1099151879 12:79124617-79124639 GAGGATGATGATAATGGCGATGG - Intronic
1099336178 12:81361339-81361361 TATGATGATTATAATGAGGATGG - Intronic
1099501931 12:83424070-83424092 TGGGATGTTGATAGTTGGGGAGG - Intergenic
1099809952 12:87568220-87568242 TAGGAGTTTGTTGATGGGGATGG - Intergenic
1100636957 12:96443713-96443735 TAGGATGTTGATGGTGGGGGAGG - Intergenic
1100642993 12:96500501-96500523 GGAGATGTTGATAATGGGGAGGG + Intronic
1100803172 12:98254406-98254428 TATGAAGTTGAAAATTGGGAAGG - Intergenic
1100992091 12:100262096-100262118 CAGGATGTTGATAATGGGGAAGG + Intronic
1101649435 12:106661474-106661496 AGGGATGTTGTTAATGGGGGAGG - Intronic
1101740661 12:107497411-107497433 GATAATGTTGATAATGGTGATGG - Intronic
1102760123 12:115377522-115377544 AAGGATGTTGGAAGTGGGGAAGG - Intergenic
1102824571 12:115937179-115937201 CAGGATGTTGATGATGGGGGAGG + Intergenic
1103227526 12:119300989-119301011 TGGGATGTTGACAGTGGGGGAGG - Intergenic
1103295550 12:119883595-119883617 GAGGATAGTGATAATGGGGCAGG - Intergenic
1104050423 12:125190581-125190603 GATGATGGTGATGATGGGGAAGG + Intronic
1104148948 12:126063439-126063461 AGGGATGTTGATATTGGGGAAGG - Intergenic
1104182958 12:126399914-126399936 GTGGATGTTGATAGTGGGGGAGG + Intergenic
1104524307 12:129504161-129504183 CAGGATGATGATGATGGTGATGG - Intronic
1104762127 12:131303397-131303419 TATGATGGTGATGATGGTGATGG - Intergenic
1104777060 12:131396313-131396335 GAGGATGTTGGTGATGGTGATGG + Intergenic
1104817649 12:131657387-131657409 TATGATGGTGATGATGGTGATGG + Intergenic
1105654266 13:22418484-22418506 GAGGAGGTTGATAATGGGGAGGG + Intergenic
1105670478 13:22608005-22608027 CAGGATGCTGATAGTGGGGGAGG + Intergenic
1105723264 13:23136776-23136798 TACGATGTTTAGGATGGGGATGG - Intergenic
1106110255 13:26771001-26771023 AAGGATGTGGATAATGGGGGAGG + Intergenic
1106175219 13:27324500-27324522 CAGGATGTTGATAGTCGGGGAGG + Intergenic
1107044595 13:35981419-35981441 CTGGATGTTGATAGTGGGGGAGG - Intronic
1107160273 13:37217642-37217664 GGGGATGATGATGATGGGGAAGG - Intergenic
1107270726 13:38613063-38613085 TAGGATGATGAGAATAGGGGTGG + Intergenic
1107431847 13:40347363-40347385 TGGGATGTTGATAGTAGGGGAGG + Intergenic
1108808060 13:54184591-54184613 TTTGATGTTGATAATGTTGATGG - Intergenic
1109339957 13:61043340-61043362 TAGGGTGGTGGTAATGGAGATGG + Intergenic
1109413761 13:62008755-62008777 GGGAATATTGATAATGGGGATGG - Intergenic
1109988450 13:70020960-70020982 GGGGATGTTGATAATAGGGGAGG - Intronic
1110202959 13:72874857-72874879 GGGGATGTTCATAATGGGGTAGG - Intronic
1110329823 13:74258669-74258691 TTGGATGTGTATGATGGGGATGG + Intergenic
1110334247 13:74308223-74308245 TAGGAAGTTGTTACTGGGCAAGG + Intergenic
1110458594 13:75718571-75718593 GGGGACGTTGATAATGGGGGAGG - Intronic
1110753432 13:79143103-79143125 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1110782290 13:79480721-79480743 GGGGATGTTGATAATGGTGGGGG + Intergenic
1110783973 13:79501367-79501389 GGGGATGTTGTTAATGGGGGAGG + Intronic
1110873496 13:80480398-80480420 GGGGATGCTGATAATGGGGGAGG - Intergenic
1110903316 13:80852843-80852865 GGGGATGTTGATAAAGGGGAAGG - Intergenic
1111516273 13:89335779-89335801 TGGGATGTTGATAGTTGGGGAGG + Intergenic
1111533081 13:89565559-89565581 CAGGATGTTGACAGTGGGGCAGG + Intergenic
1111599957 13:90460382-90460404 GGGGATGCTGATAATGGGGGAGG - Intergenic
1111605039 13:90526890-90526912 CAGAATGTTGATAATGGGGGAGG + Intergenic
1111729738 13:92058438-92058460 TGGGATGTTGATAGTGAGCAAGG - Intronic
1111807355 13:93054085-93054107 CAGGATGTTGATAGTGAGGGAGG + Intergenic
1111905967 13:94256551-94256573 GAGGATGATGATGATGGAGATGG - Intronic
1112240983 13:97680719-97680741 GGAGATGTTGATAATGGGGGAGG - Intergenic
1112292939 13:98161086-98161108 TGGGATGTTGATGGTAGGGAAGG - Intronic
1112939557 13:104844913-104844935 TGAGATGTTGATAGTGGGGGAGG + Intergenic
1112959738 13:105108822-105108844 GAGGATGTTGATTGTGGAGAAGG - Intergenic
1113237588 13:108297745-108297767 GGGGATTTTGATAATGGGGGAGG - Intronic
1113930471 13:113965817-113965839 GATGATGGTGATAATGGTGATGG + Intergenic
1113971290 13:114192289-114192311 GGGCATGTTGATAATGGGGGAGG + Intergenic
1114163444 14:20194345-20194367 TAGGATGTTGGCAGTGGAGATGG + Intergenic
1114169929 14:20262079-20262101 TGGGACATTGATAATGGGGAAGG + Intronic
1114239431 14:20852651-20852673 GGGGATGTCGATAATGGGGGAGG + Intergenic
1114358600 14:21943494-21943516 GTGGATGTTGATAATGGGAGAGG - Intergenic
1114546165 14:23503216-23503238 GGGGATGTTGATAATGGGGGAGG - Intronic
1115061511 14:29196590-29196612 TAGGATGTTGATAAGGGATCTGG + Intergenic
1115169562 14:30489039-30489061 ATGGACGTTGATAATGGGGGAGG + Intergenic
1115833940 14:37376117-37376139 CAGGATGTTGATAGTGGGAGAGG - Intronic
1116218037 14:42045505-42045527 GGGGATGTTGATAATGGGGGAGG - Intergenic
1116276223 14:42836141-42836163 GGGAATGTTGATAATGGGGGAGG + Intergenic
1116369939 14:44117596-44117618 AAGTATTTGGATAATGGGGATGG - Intergenic
1116686927 14:48051796-48051818 TGGGATATTAATAATGGAGAAGG + Intergenic
1117625417 14:57632576-57632598 GGGAATGTTGATAATGGGGGAGG - Intronic
1117794352 14:59376871-59376893 GGGGATGTTGATAATAGGGGAGG + Intergenic
1117927996 14:60805339-60805361 CAGGATGTTAATAATGGGGGAGG - Intronic
1118175886 14:63439763-63439785 TAGGATGTCCATCATGGAGATGG + Intronic
1118534718 14:66748457-66748479 AAGAATGTTGATAATGGGGGAGG - Intronic
1118842487 14:69523726-69523748 TAGGATTTTGAAAATTGGGCAGG + Intronic
1119028941 14:71176415-71176437 GGGGATGTGGATAATGGGGGAGG - Intergenic
1119197743 14:72729983-72730005 GAGGATGTTGATCATGGGGGAGG + Intronic
1120146651 14:80986016-80986038 TAGAAAGATGATCATGGGGAAGG - Intronic
1120639312 14:86991065-86991087 AGGGATGTTGATAGTGCGGAAGG - Intergenic
1120751842 14:88204822-88204844 TGGGATGTTGATAGTGGGGAAGG - Intronic
1120837519 14:89054763-89054785 GGGGATGTTGATAATGGGGGAGG + Intergenic
1121075884 14:91067843-91067865 TAAGATATTGATAATGGGCCAGG - Intronic
1121150536 14:91629582-91629604 TGGGATGTGGATAGTGGGGAAGG + Intronic
1122034892 14:98940635-98940657 TATGATTTTGATAATGAGAATGG + Intergenic
1122360213 14:101155028-101155050 CAGAATTTTGATAATGGGCAGGG - Intergenic
1123184806 14:106506486-106506508 CAGGATGGTGACAGTGGGGAAGG + Intergenic
1123399705 15:19972278-19972300 CAGGATGGTGACAGTGGGGAAGG + Intergenic
1123972781 15:25524470-25524492 GGGGATGTTGATGATGGGGGAGG + Intergenic
1124723957 15:32138463-32138485 GGGGATGTTGATGATGGGGGAGG - Intronic
1124891100 15:33733793-33733815 AGGGATAATGATAATGGGGAAGG + Intronic
1125060346 15:35413045-35413067 GGGGAGGTTGATAATGGGGGAGG + Intronic
1125119917 15:36143556-36143578 TGGGATGTTGATCATGAGGGAGG + Intergenic
1125234361 15:37495388-37495410 GGGGATGTTGATAATGGAGGAGG - Intergenic
1125262383 15:37842100-37842122 TGGGATGTTGATAGTGGGGCAGG - Intergenic
1125278217 15:38016122-38016144 GGGGGTGTTGATAATGGGGGAGG + Intergenic
1125278820 15:38022718-38022740 GGAGATGTTGATAATGGGGGAGG + Intergenic
1125742440 15:41975116-41975138 CAGGATGTTGATAGTGGGGGAGG - Intergenic
1125985903 15:44051497-44051519 TAAGATGTTAATAATAGGAAAGG - Intronic
1126298820 15:47171845-47171867 AGGGATGTTAATAATGGGAAAGG - Intergenic
1126419198 15:48453713-48453735 GAGGATGCTGATGATGGGGGAGG + Intronic
1126917294 15:53479911-53479933 TAGGATGGTAGTAATTGGGAAGG + Intergenic
1127068042 15:55260989-55261011 TGGGATGTTGATAGTGGGGGAGG + Intronic
1127492889 15:59482046-59482068 TGGGATGTTGATAGTGGGAGAGG - Intronic
1128711887 15:69878383-69878405 AAGGATGATGATAATGGAGGGGG + Intergenic
1128784795 15:70386911-70386933 TATGATTTTGCTAAAGGGGAGGG + Intergenic
1129582102 15:76822221-76822243 TATGATATTGATAATGGAGGAGG + Intronic
1129912178 15:79237090-79237112 GATGATGATGATAATGAGGATGG + Intergenic
1129996661 15:80012544-80012566 TGGGATGTTGTTAGTGGGAAAGG - Intergenic
1130135065 15:81175548-81175570 TATGATGGTGATGATGGTGATGG - Intronic
1130924571 15:88375409-88375431 TAGGAGGTGGATAGTGGGGGAGG - Intergenic
1131013154 15:89035505-89035527 CAGAATGTTGATAGTGGGGGAGG - Intergenic
1134337517 16:13314657-13314679 TATGATGTTGATTGTGGCGATGG - Intergenic
1135159437 16:20080624-20080646 CAGGATGTTGATAATAGGGGAGG - Intergenic
1135433621 16:22409030-22409052 GGGGATGTTGACAATGGGGGAGG - Intronic
1135914286 16:26591040-26591062 CAGGATGTTAATAATAGGGGAGG + Intergenic
1136107307 16:28039203-28039225 AAGGATGTCGACCATGGGGAAGG + Intronic
1137238647 16:46636272-46636294 GGGGCTGTTGATAATGGGGGAGG + Intergenic
1137628761 16:49927305-49927327 GAGGATGTTGATAATGAAGGAGG + Intergenic
1138141476 16:54572260-54572282 AACCATGTTGATGATGGGGAAGG - Intergenic
1138183745 16:54961053-54961075 AAGGATGTTGCTGATTGGGAAGG + Intergenic
1138356123 16:56381882-56381904 AGGGATGTTGATAATGGGGAAGG + Intronic
1138812983 16:60172272-60172294 TGGGATGTTGATAGTGGAGGAGG + Intergenic
1141152925 16:81577028-81577050 TATGATGGTGATGATGGTGATGG - Intronic
1141152946 16:81577182-81577204 TATGATGGTGATGATGGTGATGG - Intronic
1141813638 16:86393829-86393851 GATGATGATGATGATGGGGATGG - Intergenic
1141818398 16:86428635-86428657 TAAGATGTTAATAATGGGCTGGG - Intergenic
1141838337 16:86557794-86557816 CAGGATGTTGATAGTGGGGGAGG - Intergenic
1141880107 16:86852382-86852404 GATGATGTTGATGATGGTGATGG - Intergenic
1142103516 16:88289080-88289102 GAGGATGTTGATAGTGATGAGGG + Intergenic
1142821628 17:2473055-2473077 GGGGATGCTGATAATGGAGAAGG + Intronic
1143143795 17:4759911-4759933 CCGGATGTTGATAGTGGGGGAGG - Intergenic
1143947303 17:10604647-10604669 TGGGATGTTGATAGTCGGGGAGG - Intergenic
1144245288 17:13356786-13356808 GAGGATGTTGATAGTAGGGGAGG - Intergenic
1145108254 17:20138319-20138341 GGGGATGTTGATAATGGGAGAGG - Intronic
1145229378 17:21161260-21161282 AGGGATGTGGATAATGGGGGAGG + Intronic
1146091142 17:29879491-29879513 GGAGATGTTGATAATGGGGGAGG - Intronic
1148023166 17:44567003-44567025 AGGGATGTTGATAATGGGGAAGG - Intergenic
1148034474 17:44648484-44648506 CAGGATGCTGATATTGGGGGAGG + Intergenic
1149999376 17:61423925-61423947 GGGGATGTTGAAAATGGGGGAGG + Intergenic
1150061082 17:62068678-62068700 GGGGATGTTGATAATGAGGGAGG + Intergenic
1150386470 17:64765526-64765548 TCAGATGCTGAGAATGGGGAGGG - Intergenic
1150680988 17:67284326-67284348 GGGGATATTGATAATGGGGGAGG + Intergenic
1151087429 17:71396958-71396980 GAGGATTTTGATAATGGGGGAGG + Intergenic
1151117171 17:71750123-71750145 TAGAATGTTGAAAAGGGAGATGG - Intergenic
1151516031 17:74596513-74596535 GGGGATGTTGATAATGGGGGAGG - Intergenic
1151532925 17:74718963-74718985 GAGGGTGTTGATAATGGGGAAGG + Intronic
1152659344 17:81535258-81535280 GGGGATGGTGATGATGGGGATGG - Intronic
1152659389 17:81535387-81535409 AGGGATGGTGATGATGGGGATGG - Intronic
1152659397 17:81535417-81535439 GGGGATGGTGATGATGGGGATGG - Intronic
1153404999 18:4727852-4727874 TGGGATGTTGCTAATGGGGGAGG + Intergenic
1153792618 18:8593768-8593790 GAGGATGCTGCTAATGGGGGAGG + Intergenic
1153977614 18:10283318-10283340 TAAGATGTTGCTAAGGGAGAAGG + Intergenic
1154398659 18:14013689-14013711 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1154944425 18:21147661-21147683 TGGAATGTTGATAGTGGGGGAGG - Intergenic
1155337504 18:24779828-24779850 TAGAATGTTGACAATGAAGATGG - Intergenic
1155359140 18:24982628-24982650 AAGGATGTTGGGGATGGGGAAGG + Intergenic
1155564369 18:27117341-27117363 AGGGATGTTGAAAATGGGGGAGG - Intronic
1155764409 18:29609615-29609637 GAGGATGTTCATAATGGAGGCGG - Intergenic
1155856013 18:30835467-30835489 GAGAATGTTGATAATGGGGAAGG + Intergenic
1155880680 18:31144858-31144880 CAGGATGTTGATAGCAGGGAAGG + Intronic
1155985176 18:32222859-32222881 CAGGATGTTGATAGCGGGGGAGG - Intronic
1156054523 18:32983020-32983042 TGGGTTGTTGATAATGGAGGAGG + Intronic
1157318448 18:46614569-46614591 TGGGATGTTGGGAGTGGGGAGGG + Intronic
1157640695 18:49210751-49210773 CAGGATGTTGATAGTGGGGGAGG + Intronic
1157714128 18:49871286-49871308 TGGGAAGTTGTTAATGGGTACGG + Intronic
1158227239 18:55213971-55213993 TGGGATTTTGAAAATTGGGATGG - Intergenic
1158382822 18:56953106-56953128 GAGGATATTGATAGTGGGGGAGG + Intronic
1158395370 18:57075312-57075334 TTGGTTGTTGAAACTGGGGAAGG - Intergenic
1158420934 18:57293349-57293371 GGGGATGTTGATAATGGGAAAGG - Intergenic
1158519505 18:58159444-58159466 CAGGATGTTGATCATGGGGGAGG + Intronic
1158730956 18:60022036-60022058 GGGGATGTTGGTAATGGGGGAGG - Intergenic
1159246297 18:65809710-65809732 TCTGATGTTGATAAAGGAGATGG + Exonic
1159736511 18:72105611-72105633 TGGAATGTTGATAATGGGGGAGG + Intergenic
1159818288 18:73105593-73105615 GGGGATGTTGATAATGGAGGAGG - Intergenic
1160143166 18:76344080-76344102 GATGATGGTGATAATGGTGATGG + Intergenic
1161899397 19:7106823-7106845 TAGGATGGTGATGATGGTGATGG + Intergenic
1164534023 19:29071056-29071078 CAGGATGTTGATAGTTGGGGAGG + Intergenic
1165588885 19:36947906-36947928 CAAGATGTTGACAGTGGGGAAGG - Intronic
1165613924 19:37182047-37182069 GGGGATGTTGATGATGGGGGAGG + Exonic
1167764947 19:51475856-51475878 GGGGCTGTTGATAATGGGGGTGG + Intergenic
1167839990 19:52107979-52108001 GAGGATGTTGACAATGGGGAAGG + Intergenic
1167975066 19:53219540-53219562 TGGGTTGTTAATAATGGGGGAGG - Intergenic
1168329324 19:55557551-55557573 GGGGATGTTGATAGTGGGGGAGG - Intergenic
924971839 2:135583-135605 GGTGATGTTGATAATGGGGGTGG + Intergenic
925483001 2:4297323-4297345 TGGGATGTTGATAATGGAGAAGG - Intergenic
926204728 2:10828037-10828059 TGGGATGTTGATAGTGGGGAAGG - Intronic
926381915 2:12299510-12299532 TAGGGTAGTGATAATGGAGATGG + Intergenic
926774656 2:16409897-16409919 GAGGGTGTTGATAATGATGATGG - Intergenic
926780874 2:16470770-16470792 GGGGATGTTGATAATGGGGGAGG + Intergenic
927384548 2:22518106-22518128 TTGGATGTGGATGATGGGGGAGG - Intergenic
927918689 2:26954115-26954137 TAGGATGTTAGTAATAGGGGAGG - Intergenic
927931064 2:27044613-27044635 TGGGATGTTGATGGTGGGGGAGG - Intronic
928020766 2:27703036-27703058 GGGAATGTTGATAATGGGGGAGG - Intergenic
929095323 2:38258178-38258200 GGGGATGTTGATAGTGGGGTGGG - Intergenic
929344844 2:40869426-40869448 CGGGATGTTGATAATGGGAGAGG - Intergenic
929734165 2:44527789-44527811 GAGTATATTGATAATGGGGGGGG - Intronic
930046952 2:47180950-47180972 GATGATGTTGACAATGGAGATGG - Intergenic
931276815 2:60751369-60751391 CAGGATGTTGATAATGGAGGAGG + Intergenic
931345682 2:61443871-61443893 TCAGATGTTGATAATGGAGGAGG + Intronic
931965501 2:67529216-67529238 CAGGATGTCTATAATGGGGGAGG + Intergenic
932406929 2:71519506-71519528 TGGGATGATGATAGTGGGGAAGG - Intronic
932470722 2:71953602-71953624 GGGGATGTTGATAATGAGGAAGG - Intergenic
932488920 2:72106071-72106093 GGGGATGTTAATAATGGGGGAGG - Intergenic
932923764 2:75946404-75946426 GGGGATGTTGACAATGGGGGAGG - Intergenic
933299219 2:80523763-80523785 TGAAAAGTTGATAATGGGGAAGG + Intronic
933531130 2:83513740-83513762 GTGGATGTTGATAATGGGGGAGG + Intergenic
933578718 2:84100733-84100755 CAGGATGTTGATACTGGGAGAGG + Intergenic
933841930 2:86294151-86294173 TAGGGAGTTGATAATGGGTGTGG + Intronic
935209245 2:100924179-100924201 GGGGATGCTGATAATGGGGGAGG - Intronic
935396308 2:102613056-102613078 AAGGATGGTGATGATGGTGATGG - Intergenic
935506273 2:103908057-103908079 AAGGATGCTGATAATGGAGGAGG - Intergenic
935853641 2:107250026-107250048 GTGGATGATGATAATGGTGAAGG - Intergenic
936919414 2:117672212-117672234 GGGGATGTTGATAATGGGGGAGG + Intergenic
936941909 2:117892116-117892138 TGGGATGTTGATGGTGGGGGAGG - Intergenic
936958772 2:118050783-118050805 TAGGATGTTAATAATGCTGCGGG - Intergenic
937119832 2:119433402-119433424 CAGGATGTTGACGATGGTGATGG + Intronic
937344189 2:121113413-121113435 CAGAATGTTGATAATAGGGGAGG + Intergenic
938129979 2:128706989-128707011 TGGGAGGTAGATAATGGGGGTGG - Intergenic
939145141 2:138404595-138404617 GAGGATGTTGGTAATGGAGGAGG + Intergenic
939173817 2:138726709-138726731 CAGGATGCTGACAATGGGGGAGG - Intronic
939255959 2:139745064-139745086 TAGGATGGTGGTAATGGTGGGGG + Intergenic
939331266 2:140764716-140764738 TGAGATGTTGATAGTGGGCAAGG - Intronic
939395777 2:141627843-141627865 CAGGATGTTGATAGTAGGGGAGG + Intronic
939857850 2:147382033-147382055 TGGGATGTTGATAATTGGGGAGG + Intergenic
939940550 2:148345097-148345119 CAAGATGTTGATAATGGGGGAGG + Intronic
939962094 2:148574223-148574245 TGGGGTGTTGATAGTGGGGGAGG + Intergenic
940425010 2:153521472-153521494 CGGGATGTTGATAATGAGAAAGG - Intergenic
940996479 2:160155516-160155538 GGAGATGATGATAATGGGGAAGG + Intronic
941002077 2:160212897-160212919 TAAGATATTAATAATAGGGACGG - Intronic
941089553 2:161159283-161159305 AGGGATGTTGATAATGGGGAAGG + Intronic
941484790 2:166066735-166066757 TAGCATTTTGACAATGGAGATGG - Intronic
941508625 2:166377487-166377509 GGGAATGTTGATAATGGGGGAGG - Intergenic
941553690 2:166948278-166948300 CAGGATGTTGATAATGAGCAGGG + Intronic
941603605 2:167567665-167567687 GGGGATGTTGATAACGGGGAAGG - Intergenic
941611000 2:167662421-167662443 TGGGATGTTGATGATGTGGGAGG - Intergenic
941717429 2:168778834-168778856 GGTGATGTTGATAATGGGGGAGG + Intergenic
941733400 2:168945179-168945201 GGAGATGTTGATAATGGGGGAGG + Intronic
941837002 2:170034110-170034132 GTGGATATTGATAATGGGAAAGG - Intronic
942111940 2:172691210-172691232 TGGGATGTTGACAATTGGGAAGG - Intergenic
942287018 2:174429555-174429577 TGGGATGTTGATAGTGGGGGAGG - Exonic
942530890 2:176909129-176909151 GGGGATGTTGATAATGGAGGAGG + Intergenic
942720198 2:178942720-178942742 GGGGATGTTGATTATGGGGGAGG + Intronic
942761712 2:179406571-179406593 GGGGATGTTGATAATAGGGAAGG - Intergenic
942919028 2:181348300-181348322 GGGGATGTTGATAATGGGGGAGG + Intergenic
942991264 2:182206333-182206355 GGGGATGTTGACAATGGGGGAGG - Intronic
943032005 2:182696679-182696701 GGGGATGTTGACAATGGGGGAGG + Intergenic
943562206 2:189477418-189477440 AGAGATGTTGATAATGGGGTAGG - Intergenic
943822316 2:192341156-192341178 GAAGATGTTGATAATGGGAGAGG - Intergenic
944080611 2:195784022-195784044 ATGGATGTTGATACTGGGGGAGG - Intronic
944194500 2:197038214-197038236 GAGGATGATGATAATGGAGGAGG + Intronic
944270158 2:197773910-197773932 TCGGGTGTTGGTAATGGAGATGG + Intronic
944443435 2:199765308-199765330 GGGAATGTTGATAATGGGGTAGG + Intronic
944476093 2:200108208-200108230 TGGGATGTTGATAGTGGTGTTGG + Intergenic
944726795 2:202479555-202479577 GGGAATGTTGATAATGGGGGAGG - Intronic
944860670 2:203812924-203812946 TGAGATGTGGATAATGGTGATGG - Intergenic
945238446 2:207654324-207654346 CAGGATGTTGATAATGGTAAAGG + Intergenic
945536869 2:211028062-211028084 GGGGATGTTGTTAATGGGGAAGG - Intergenic
945571893 2:211478658-211478680 TAGGATGTTGAAAGCAGGGATGG - Intronic
945674131 2:212834348-212834370 TGGGATATTGATAGTGGGGGAGG - Intergenic
945712625 2:213317846-213317868 GGGGCTATTGATAATGGGGAAGG + Intronic
946174638 2:217915011-217915033 GAGGATGCTGAGCATGGGGAGGG - Intronic
946671748 2:222112137-222112159 GAGGATGTTGATAATGGGGGAGG + Intergenic
947382995 2:229563358-229563380 GAGGATGATGATGATGGTGATGG - Intronic
947383013 2:229563465-229563487 GATGATGATGATAATGGCGATGG - Intronic
947383055 2:229563737-229563759 GAGGATGATGATGATGGTGATGG - Intronic
947383084 2:229563893-229563915 GAGGATGATGATGATGGTGATGG - Intronic
947383090 2:229563922-229563944 GAGGATGATGATAATGGTGATGG - Intronic
947383104 2:229564003-229564025 GAGGATGATGATGATGGTGATGG - Intronic
947383114 2:229564058-229564080 GAGGATGATGATGATGGTGATGG - Intronic
947383123 2:229564113-229564135 GAGGATGATGATGATGGTGATGG - Intronic
947383180 2:229564495-229564517 GAGGATGATGATGATGGTGATGG - Intronic
947545089 2:231004941-231004963 GATGATGGTGATAATGGTGATGG - Intronic
948183186 2:235999163-235999185 GATGATGATGATAATGGTGATGG + Intronic
948564336 2:238874083-238874105 CAGGATGTTGATGGAGGGGATGG + Intronic
1170008208 20:11692157-11692179 TAGGATGTTGACAGTTGGGGAGG + Intergenic
1170417042 20:16155675-16155697 GAGGATGTTCATAATGGGGGAGG + Intergenic
1170643042 20:18172848-18172870 TAGGCTGTTGGAAATGGGGGAGG + Intronic
1170651476 20:18246493-18246515 GGGGATGTTAATAATGGGGGAGG - Intergenic
1170880294 20:20291094-20291116 GGGGATGTTGATAGTGGGGGAGG - Intronic
1171280372 20:23891027-23891049 GATGATGGTGATAATGGTGATGG - Intergenic
1171384522 20:24761156-24761178 TGGGATGTTGATAATGGGGAAGG + Intergenic
1172553790 20:35822914-35822936 CAGGATGTTGAAAGTGGGGGAGG - Intronic
1172856324 20:38006196-38006218 TCGGATTTTGATAATGAAGAAGG - Exonic
1172898118 20:38314818-38314840 GGGGATGATGATAATGGTGATGG + Intronic
1173848802 20:46204795-46204817 TAGGGTGGAGAAAATGGGGAGGG + Intronic
1174010914 20:47448957-47448979 CAGGATGTTGATAATCAGGGAGG + Intergenic
1174646436 20:52089843-52089865 TGTAATGTTGGTAATGGGGAAGG + Intronic
1174714539 20:52743725-52743747 TAGTATGTAGATTATGGGGCAGG - Intergenic
1175011664 20:55744124-55744146 GCGGGTGTTGATAGTGGGGAAGG + Intergenic
1175511604 20:59531529-59531551 GGCGATGTTGATAATGGGGGAGG + Intergenic
1175539320 20:59738318-59738340 AAGGATGATAATAAGGGGGAGGG + Intronic
1175670174 20:60895687-60895709 AGGGATGATGATAATGGTGATGG + Intergenic
1175764935 20:61585815-61585837 GAGGATGGTGATGATGGTGATGG + Intronic
1176889148 21:14293371-14293393 GAGGATGTTGATAATGGGGGAGG + Intergenic
1177001123 21:15614493-15614515 GGGGATGTTGATAATGGGGAAGG + Intergenic
1177172040 21:17665812-17665834 CAGGATGTTGATTGCGGGGAAGG + Intergenic
1177633877 21:23761001-23761023 TGGGATGTTGATAATGGAAGAGG + Intergenic
1177670000 21:24212646-24212668 GGGGATGTTGATAATAGGGGAGG + Intergenic
1177875764 21:26629466-26629488 TAGAATGATGGTTATGGGGAGGG - Intergenic
1177935587 21:27341308-27341330 CAGGATGTTGATAATGAGGCAGG + Intergenic
1178104410 21:29301550-29301572 TACATTGTTGATACTGGGGATGG + Intronic
1178381157 21:32110040-32110062 GGGGATGTTGATAATGGGGAAGG + Intergenic
1178673390 21:34612087-34612109 TAGGATGGTGGTATTGGAGATGG - Intronic
1178861057 21:36290109-36290131 CAGGATGTTGATAATACGGCAGG + Intronic
1179057541 21:37949953-37949975 GGGGATGTTGATAGTGGGGGAGG + Intergenic
1179192626 21:39136353-39136375 GAGGATGTTGATAATGGCGGAGG + Intergenic
1179227644 21:39469198-39469220 GGGGATGTTGATAATGGGGGAGG - Intronic
1180019330 21:45111396-45111418 ACGGATGTTGATAATGGGGGAGG - Intronic
1180153154 21:45962780-45962802 CAGGAGGCAGATAATGGGGAGGG - Intergenic
1180194659 21:46185574-46185596 TAGTTTGTTGATAATAGGGGAGG + Intergenic
1180237399 21:46471431-46471453 TGGGATGCTGATAATGCGGGAGG - Intronic
1181054118 22:20251982-20252004 GAGGATGGTGATGATGGTGATGG - Intronic
1181727535 22:24821856-24821878 GAGGATGTTGACAGTGGGGTAGG - Intronic
1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG + Intronic
1183766456 22:39880538-39880560 GGGGATGTTTATAATGGGGGAGG + Intronic
1183818271 22:40322297-40322319 GAGGATGTTGATAATAGTGGAGG - Intronic
1184073134 22:42159004-42159026 TGGGATGTTGATAGAGGGAAAGG + Intergenic
1184666803 22:45993601-45993623 AATGATGGTGATAATGGTGATGG + Intergenic
1185003433 22:48261098-48261120 GATGATGGTGATAATGGCGATGG - Intergenic
1185013485 22:48330186-48330208 TAGGATGCTGGTAATGGTGGAGG - Intergenic
1185215429 22:49597322-49597344 GATGATGGTGATAATGGTGATGG + Intronic
949412214 3:3778372-3778394 GATGGTGTTGATGATGGGGATGG - Intronic
949428853 3:3950511-3950533 CAGGATATTGATAATGGGGAAGG + Intronic
949499289 3:4663582-4663604 TAGGATGTCGGTAGTGGGGGAGG - Intronic
950799435 3:15537923-15537945 AATGCTGTTGATAGTGGGGAAGG + Intergenic
950807172 3:15615691-15615713 TGGGATATTGATAACAGGGAAGG - Intronic
951066214 3:18268735-18268757 TAGGATGTTGAAAGTGGGGGTGG + Intronic
951240624 3:20282331-20282353 TAGGTTGTTCATATTGGGTATGG + Intergenic
951436649 3:22672986-22673008 TGGGATGTTGATAGTTGGGGAGG + Intergenic
951829691 3:26912250-26912272 CAGGATGCTGATAATGGGGGAGG + Intergenic
952009615 3:28885510-28885532 TAGGCTGTTAAGAATGTGGAGGG + Intergenic
953192655 3:40702090-40702112 CAGGATGTTGAGAGTGGGGGAGG - Intergenic
953203580 3:40799997-40800019 CAGGATGTTTTTGATGGGGAGGG - Intergenic
953569792 3:44062397-44062419 TAGGATGTTGATAATATCGCAGG + Intergenic
954555240 3:51512508-51512530 TAGGATGTTGATAATGGAGGAGG + Intergenic
955677960 3:61469206-61469228 CAGGATGTGGATAATTGGGGAGG - Intergenic
955677975 3:61469331-61469353 CAGGATGTTGATAATAGGGGAGG - Intergenic
956092567 3:65683354-65683376 GGGGATGTTGATAATGTGGGAGG + Intronic
956115862 3:65917986-65918008 GGGGACGTTGATAATGGGGGAGG + Intronic
956495114 3:69816805-69816827 GATGATGTTGATAATGGTGGTGG + Intronic
956508134 3:69964600-69964622 GGGAATGTTGATAATGGGGAAGG - Intronic
956676394 3:71736866-71736888 TGGCATGTTGATAATGGAGAAGG + Intronic
956771426 3:72529291-72529313 GGGGATGTTGATAGTGGGGGAGG + Intergenic
957005426 3:74940228-74940250 TGGGATGTTGATAATAAGGAAGG + Intergenic
957676423 3:83372770-83372792 GGGGATGTTGATAATGGGAGAGG + Intergenic
957901756 3:86503333-86503355 AGGAATGTTGATAATGGGGGAGG - Intergenic
958031295 3:88114240-88114262 TGGCATGGTGATATTGGGGAAGG + Intronic
958065511 3:88540638-88540660 GAGGATATTGATAATGGGAAAGG - Intergenic
958889974 3:99772514-99772536 CAGGATGTTCATAATGGGGGAGG + Intronic
959181092 3:102981006-102981028 GAGGATGTGGAGAAAGGGGAAGG + Intergenic
959243273 3:103828559-103828581 GTGGATGTTTATAATGGGGGAGG + Intergenic
959300375 3:104591911-104591933 GAGGATGTTTATAATGTGGGAGG + Intergenic
959362408 3:105409922-105409944 GAGCATGTTGATAATGGAGAAGG - Intronic
959633042 3:108530634-108530656 GGGGATGTTGATAATGGGTGAGG + Intergenic
959753567 3:109868460-109868482 TGGGATGTTGATAATGGCTGAGG + Intergenic
959877001 3:111395050-111395072 AGGGATGTTGATAATGAGGGAGG - Intronic
959898827 3:111636986-111637008 TCAGATGTCTATAATGGGGAAGG - Intronic
959933512 3:112007184-112007206 GGGGATGTTGATAATGGGGAAGG - Intronic
960717365 3:120590029-120590051 GAGGATGTCGATAACGGGGGAGG + Intergenic
962237707 3:133721819-133721841 TATGATGATGATAATGATGAAGG - Intergenic
962621408 3:137183643-137183665 CGGGGTGTTGATAATGGGGGAGG - Intergenic
962699906 3:137987787-137987809 GGGGATGTTGATAATGGGAGAGG - Intergenic
962822442 3:139064300-139064322 TAGGATGTTGACAGTTGGGTAGG - Intronic
962992899 3:140595667-140595689 GGGGATGTTGATGATGGGGGAGG - Intergenic
963824940 3:149943331-149943353 CAGGATGTTGATAATTGGTAAGG - Intronic
963824951 3:149943456-149943478 CAGGATGTTGATAATAGGGGAGG - Intronic
963845847 3:150157246-150157268 TGAGATGTTGATAATTGGGAAGG + Intergenic
963848858 3:150187611-150187633 GGGGATGTTGATAGTTGGGAAGG - Intergenic
964617085 3:158677975-158677997 TAGGATTTTGACAATGAGAAAGG - Intronic
964625540 3:158755135-158755157 CAGGATGTTGATAGTGGGAGAGG - Intronic
964679956 3:159327533-159327555 TAATATGTTGGTAAGGGGGATGG + Intronic
964917729 3:161856316-161856338 GGGTATGTTGATAATGGGGGAGG + Intergenic
965641520 3:170833741-170833763 GGGGATGTTGATAATGGGAGAGG - Intronic
966098535 3:176237875-176237897 CAGGATGTTGATGGTGGGGGAGG + Intergenic
966399361 3:179532663-179532685 TGGGATGTTGACAGTGGGGGAGG - Intergenic
966642832 3:182209725-182209747 TAAGATGTTAATAATGGTGTGGG - Intergenic
967454712 3:189671202-189671224 TATGATTTTAATAATGGGCAAGG + Intronic
968023284 3:195415174-195415196 CAGGATGTTGATAGTGGGGAAGG + Intronic
968202996 3:196772114-196772136 TAGCATTTTGAAAATGGTGATGG - Intronic
969109675 4:4836077-4836099 AGGGATGTTGATAATGGTGGAGG + Intergenic
969503098 4:7566305-7566327 GATGATGGTGATAATGGTGATGG + Intronic
970226579 4:13864575-13864597 TAGGATATTGATAATGAGGGAGG - Intergenic
970255122 4:14160095-14160117 TGTGATGTTGATAGTGGGGAAGG - Intergenic
970750865 4:19358922-19358944 AAGGATGTTGATAATGAAGGAGG + Intergenic
970923994 4:21428909-21428931 TAAGATATTGATAATGGGGTAGG - Intronic
971189218 4:24411451-24411473 TGGGATGTTGATAGTAGGGCAGG - Intergenic
971190060 4:24419433-24419455 TAGGATGCTGCTAAGGGGAAGGG - Intergenic
971306065 4:25482717-25482739 GGGAATGTTGATAATGGGGGAGG + Intergenic
971577540 4:28295061-28295083 AAGGATGTTGAAAGTGGGGGAGG + Intergenic
971619165 4:28831583-28831605 TAGGATAGTGATAATAGAGATGG - Intergenic
971991728 4:33906758-33906780 GAGGATGTTGATAATGAGGGAGG + Intergenic
971992682 4:33920363-33920385 GGGGATGTTGATAATGGGGGAGG - Intergenic
972062793 4:34899536-34899558 GAAGATGTTGATAATGGAAAAGG + Intergenic
972615836 4:40697139-40697161 GAAGATGTTGATAATAGGGGAGG + Intergenic
973289172 4:48453404-48453426 GGGGATGTTGATAATGGGGGAGG + Intergenic
973930115 4:55783622-55783644 GAGGATGCTGATGATGGGGTAGG - Intergenic
974394026 4:61311950-61311972 TGGGATGTTAATAATGGGGGAGG + Intronic
974509581 4:62821262-62821284 GAGGATGTTGATAATAGGGAAGG - Intergenic
974632618 4:64513423-64513445 GGGGATGTTAATAATGGGGGAGG + Intergenic
974843571 4:67324467-67324489 AGGGGTGTTGACAATGGGGAAGG + Intergenic
975124500 4:70766660-70766682 TGGGATGTTGATAATGAGGGAGG - Intronic
975646806 4:76553897-76553919 CAGGATTTTGATAGTGGGGGAGG - Intronic
975977114 4:80112131-80112153 GGGGATGTTGATAGCGGGGAAGG + Intronic
976280620 4:83323381-83323403 GGGGATGTTGATAATGAGGGAGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976818696 4:89180235-89180257 TGGGATGTTGATAGTTGGGGAGG - Intergenic
977003830 4:91540164-91540186 TGGGATGTAGAGAGTGGGGAAGG - Intronic
977100215 4:92802225-92802247 TATGATGTTGATAATGGAGAAGG - Intronic
977314621 4:95430221-95430243 CAGGATGTTAATAATGAGGGAGG + Intronic
977374282 4:96181453-96181475 TAGAATGCTGTTCATGGGGAGGG - Intergenic
977428364 4:96899207-96899229 GAGGACGTTGATAATGAGGGAGG + Intergenic
977454603 4:97242479-97242501 GAAGATGTTGATAGTGGGGGAGG + Intronic
977574387 4:98660502-98660524 GGGGATGTTGACAATGGGGGAGG - Intergenic
977763363 4:100767149-100767171 AAGGATGTCGACAGTGGGGAAGG + Intronic
977822192 4:101486049-101486071 CAGGATGTTGATAATGGAGGAGG - Intronic
978033016 4:103959006-103959028 GGGGATGTTGATAATGGAGGAGG + Intergenic
978051967 4:104212177-104212199 CAGGATGTTGATAGTGAGGGAGG - Intergenic
978129552 4:105178629-105178651 TGGGATGTTGATAATGGGGAAGG + Intronic
978135412 4:105251967-105251989 AAGGATGTTGATAATGAGGGAGG - Intronic
978188571 4:105886621-105886643 TACCATGTTGATAATGGGAGAGG - Intronic
978243668 4:106547414-106547436 TGGGATGTTGATAATGGGGGAGG + Intergenic
978415645 4:108473082-108473104 GGGGATATTGATAATGGAGAAGG + Intergenic
978686157 4:111446012-111446034 AGGGATGTTGATAATGTGGGAGG + Intergenic
979035926 4:115717423-115717445 TGGGATGGTGATAATGGGTGAGG - Intergenic
979162932 4:117486782-117486804 GGGGATGTTAATAATGGGGGAGG - Intergenic
979607243 4:122651695-122651717 TGGGATGTTGAAGATGGTGAGGG - Intergenic
979706669 4:123727865-123727887 CAGGATTTTGATAGTGGGGAAGG - Intergenic
979748830 4:124250543-124250565 AAGGATGTTGGTAATGAGGGAGG + Intergenic
980378890 4:131984807-131984829 GGGGACATTGATAATGGGGAAGG - Intergenic
980617394 4:135248179-135248201 TAAGATGTTTATAATGGCAATGG - Intergenic
981118256 4:141017434-141017456 TGGGATGTTGATGATGGAGGAGG - Intronic
981217817 4:142191712-142191734 TATGATGTTTATAATAGTGATGG + Intronic
981757004 4:148151061-148151083 TTGGATGTGGATAGTGGTGATGG + Intronic
982033855 4:151326248-151326270 GGGGATGTTGATAATGGGGGAGG + Intergenic
982083333 4:151810921-151810943 TAAGATGTGGAGAATTGGGATGG + Intergenic
982168357 4:152637061-152637083 GGGGACGTTGATAATGGGGGAGG + Intronic
982211938 4:153044828-153044850 GGGTATGTTGATAATGGGGGAGG + Intergenic
982491243 4:156032129-156032151 GAGGATGTTGATAATGGAGGAGG - Intergenic
982852162 4:160332046-160332068 TGGGATGTTGATAGTGGGAGAGG + Intergenic
982967257 4:161927942-161927964 TAGGGTGTTAATGGTGGGGAAGG - Intronic
982993403 4:162309206-162309228 TAGGATAGTGATCATGGGGTTGG + Intergenic
983110702 4:163745947-163745969 GGGGGTGTTGATAATGGGGGAGG - Intronic
983372109 4:166873465-166873487 GAGGATGTTGATAATGGAAGAGG + Intronic
983376032 4:166929066-166929088 GAGTATGTTGATAATGGGGAGGG + Intronic
984292630 4:177814564-177814586 GGGGATGTTGATAATAGGGGAGG - Intronic
984313617 4:178097368-178097390 GGGGATGTTGATAATGGGGAAGG + Intergenic
985294892 4:188426078-188426100 TATGATGTTGATAATGGTGGTGG - Intergenic
985857281 5:2439510-2439532 TAGGATGATGATTATGGTGATGG - Intergenic
985920144 5:2964747-2964769 TAGGGACTTGATAATGGGAATGG - Intergenic
986373944 5:7110970-7110992 GGGGATGTTGATAATGGGAGAGG + Intergenic
986436750 5:7741647-7741669 GATGATGATGATAATGAGGATGG - Intronic
986436771 5:7741815-7741837 GAGGATGGTGATGATGGTGATGG - Intronic
986538521 5:8817724-8817746 TAAGATGTTGATAGTGGGGGAGG - Intergenic
986797047 5:11222855-11222877 TGGGATGTTGGAGATGGGGAGGG - Intronic
986839000 5:11674451-11674473 GGGGATGTTGATAATGAGGGAGG - Intronic
986877426 5:12128355-12128377 GGGGATGTTGATAATGAGGGAGG + Intergenic
987024085 5:13906317-13906339 GGGGATGTTCATAATGGGGGAGG + Intronic
987420740 5:17717297-17717319 GGGGATGTTGTTAATGGGGGAGG + Intergenic
988700514 5:33669350-33669372 GAGGATGTTGCCCATGGGGATGG + Intronic
988908606 5:35816170-35816192 TTAGATGTTGATAAGGGCGATGG - Intergenic
989395797 5:40955026-40955048 GGAGATGTTGATAGTGGGGAAGG - Intronic
989711870 5:44407964-44407986 CAGGATGTTGATAGTGGGGGCGG + Intergenic
989809003 5:45649350-45649372 GGGGATGTTGATAATGGGGAGGG - Intronic
989822526 5:45811305-45811327 TAGGATGTTGGTAATGGGAAAGG + Intergenic
989843921 5:46115653-46115675 GGGGATGTTGATAGTGGGGAAGG - Intergenic
990369349 5:55101690-55101712 CAGGATGTTAACTATGGGGATGG + Intergenic
991008200 5:61853062-61853084 GGGTATGTTGATAATGGGGAAGG + Intergenic
991146425 5:63310721-63310743 CAGGATGTTGATATTGGGAGAGG + Intergenic
991688307 5:69201981-69202003 GGGGATGTTGATAATGGGAGAGG + Intronic
991981434 5:72235563-72235585 CAGGATGTTGATTATGAGGAAGG + Intronic
992033814 5:72751470-72751492 AAGGAAGTAGATAATGGGGAAGG + Intergenic
992194131 5:74323127-74323149 TAGGGGGTTGTTTATGGGGAGGG + Intergenic
992215624 5:74522314-74522336 TAGGATTTGGAAAATGGGAAAGG + Intergenic
992393170 5:76347852-76347874 AGGGGTGTTGATAATGGGAAAGG - Intronic
992544843 5:77803048-77803070 GAAGAAGTTGATAATTGGGAAGG + Intronic
993935722 5:93999601-93999623 GAGGCTGTTGATAATGAGGGAGG - Intronic
994096950 5:95855977-95855999 CACGATGTTAATAATAGGGAAGG - Intronic
994260102 5:97647964-97647986 TAAGATGTTGATAGTAGGGGAGG - Intergenic
994658333 5:102621872-102621894 CAGGATGCTGTTACTGGGGAAGG + Intergenic
994896449 5:105710154-105710176 CAGGATGTTGATCGTGAGGAAGG - Intergenic
994982205 5:106890059-106890081 TAGGATATTTATAATGGAGAGGG - Intergenic
995204571 5:109464569-109464591 TTGGATATTGAAAATGGAGATGG + Intergenic
995385901 5:111588465-111588487 TAGGAGGTGGAGTATGGGGAAGG - Intergenic
995469688 5:112488014-112488036 AGGGATGTTGGTAATGGGGGAGG - Intergenic
995577000 5:113547553-113547575 GGGGATGTTGATAATGGGGGAGG + Intronic
995684283 5:114754992-114755014 TATAATTTTGATAGTGGGGAGGG - Intergenic
995802900 5:116018939-116018961 CAGGATGTTGATAGAGGGGGAGG - Intronic
995963238 5:117871509-117871531 TAGGTTGATGAAAATGTGGATGG + Intergenic
996002434 5:118380827-118380849 AGGGATGTTGATAATGGGGTGGG - Intergenic
996070761 5:119128664-119128686 GTGGATGTTGATAATGTGGGAGG + Intronic
996285564 5:121787125-121787147 TAGGATGTTCATTATGGGAGTGG - Intergenic
996580063 5:125021824-125021846 GAGGATATTGATAATGGGGGAGG + Intergenic
996987651 5:129586105-129586127 GTGAATGTTGATAATGGGGGAGG - Intronic
997054952 5:130431110-130431132 GGGGATGTTGATAATGGAGGAGG + Intergenic
998311119 5:141133355-141133377 GAGGATGTTGATAATGGGTGAGG + Intronic
998361889 5:141595377-141595399 GGGGATGTTGACAATGGGGGAGG + Intronic
999045554 5:148465294-148465316 GAGGATATTGACAATGGGGGAGG + Intronic
999045988 5:148470034-148470056 TATAATGATGATAATGGTGATGG + Intronic
999077472 5:148810303-148810325 TGGGATGTTGCTAGTAGGGAAGG - Intergenic
999328676 5:150658657-150658679 CAGGATGTTGCTAAAGGTGAGGG + Intronic
999418914 5:151423848-151423870 GTGGATGTTGATAATGGGAGAGG + Intergenic
999503093 5:152166215-152166237 AAGGAGGTTGAAAATGGGGTGGG + Intergenic
999740843 5:154550238-154550260 TAGGATGCTGGTAGTGGGGGAGG - Intergenic
999846146 5:155482683-155482705 GTGGATGTAGATAATGGGGGAGG + Intergenic
1000405393 5:160882317-160882339 GGGGATGTTGATAATGGGAGAGG + Intergenic
1001143771 5:169166645-169166667 TAGGAAGGTGATATTGGGGATGG - Intronic
1001207594 5:169779002-169779024 AGGGATGTTGATAGTGGGGAAGG + Intronic
1001591517 5:172868759-172868781 CAGGATGTTGATAGTGAGGGAGG + Intronic
1001791602 5:174462267-174462289 TGGGATGTTAATCATGGGAAAGG - Intergenic
1001923690 5:175620518-175620540 AAGGATGATGATCATGGTGATGG + Intergenic
1001923777 5:175621281-175621303 GGTGATGTTGATAATGGTGATGG + Intergenic
1002084511 5:176764215-176764237 GGGGACGTTGATAATGGGGGAGG - Intergenic
1003522096 6:6867034-6867056 GGGGATGTGGATTATGGGGAAGG - Intergenic
1004244433 6:13959567-13959589 TAGGATGTTGATGATGAAGATGG + Intronic
1004788321 6:18994517-18994539 AGGAATGTTGGTAATGGGGAAGG - Intergenic
1004794098 6:19061909-19061931 GTGGATATTGATAATGGGGGAGG - Intergenic
1004815450 6:19307474-19307496 AAGGATGTTGATAACAGGGGAGG + Intergenic
1004839213 6:19563253-19563275 TAGGAAGTTGATTTGGGGGATGG + Intergenic
1005052094 6:21694415-21694437 TTGGATCTTGAGAGTGGGGAGGG + Intergenic
1005523050 6:26617022-26617044 CAGGATGTTGATAGTGGAGGAGG + Intergenic
1005600407 6:27421291-27421313 AAGGAAGTTGATAATGGGAGAGG + Intergenic
1005688453 6:28278700-28278722 GGGGATGTTGATAATAGGGGAGG - Intronic
1005823170 6:29614887-29614909 GAGGATGTCGATAATGTAGAAGG + Intronic
1005833276 6:29687956-29687978 TAAGATGTTAACAATGGGGCTGG - Intergenic
1006590637 6:35153291-35153313 GGGGATATTGATAATGGGGGAGG - Intergenic
1006992634 6:38228470-38228492 GAGGATGTTGATACTTGGGGAGG + Intronic
1007624339 6:43234795-43234817 AGGGATGTTGATAATGGCGGAGG + Intergenic
1007634985 6:43294178-43294200 TGTGATGTTGATAATGATGATGG - Intergenic
1007968686 6:46028735-46028757 ATGAATGTTGATAATGGGGGAGG - Intronic
1008322848 6:50139153-50139175 ATGGATGTTGATAATGAGGGAGG - Intergenic
1008449008 6:51627679-51627701 CAGGTTGTTGACAATGGAGAAGG - Intronic
1008809602 6:55479939-55479961 AAAAATGTTGGTAATGGGGATGG - Intronic
1008976213 6:57430037-57430059 TAGGAAGTTGAAATTGGGGATGG + Intronic
1009164736 6:60327177-60327199 TAGGAAGTTGAAATTGGGGATGG + Intergenic
1009266495 6:61561868-61561890 TAGGCTGTTGGGAGTGGGGAGGG - Intergenic
1009459617 6:63896491-63896513 TGGGATGTTGATATTGAGGAAGG - Intronic
1009532066 6:64830344-64830366 AGTGATGCTGATAATGGGGAGGG + Intronic
1009910348 6:69918344-69918366 TAGCATGGTGATAGTGGAGATGG + Intronic
1010118759 6:72347794-72347816 TAGGAAGTTGATATTTGGGTAGG - Intronic
1010163687 6:72890205-72890227 TAGTATGCTGATTATGGTGATGG - Intronic
1010801631 6:80183530-80183552 GGGGATGTTGGCAATGGGGAAGG - Intronic
1010908171 6:81519150-81519172 TGGGATGTTGATAGTGAGGGAGG + Intronic
1011519475 6:88189121-88189143 CAGGATGTTGATAGTTGGGGAGG - Intergenic
1011658292 6:89571701-89571723 GCGGATGTTGATAATGGGATAGG - Intronic
1012163472 6:95918215-95918237 GGGGATGTTGATAATGAGGGAGG + Intergenic
1012320906 6:97844390-97844412 AGGGATGTTGATAATGGGGAAGG - Intergenic
1012535916 6:100296697-100296719 AAGGATGTTGATAATGAGAAGGG + Intergenic
1012583893 6:100899335-100899357 TAGGAGGAAGATAAGGGGGAGGG + Intergenic
1013114960 6:107096091-107096113 TACAATGTTGACAATGGGGGAGG + Intronic
1013720726 6:113024966-113024988 GGGGATGTTGATAATAGGGATGG + Intergenic
1013845629 6:114447593-114447615 AGGAATGTTGATAATGGGGGAGG - Intergenic
1014333798 6:120105669-120105691 GAGGATGTTGATAATGGGGGAGG - Intergenic
1014701042 6:124688410-124688432 GAGGATGCTGATAATGGGGGAGG - Intronic
1014716442 6:124869826-124869848 GAGGATGTTGATAGTGGGGAAGG + Intergenic
1014775276 6:125501929-125501951 GGGGATGTTGATAATGAGGGCGG + Intergenic
1015767450 6:136733727-136733749 GGGGATGTTGACAATGGGGGAGG - Intronic
1016133030 6:140501009-140501031 AAGGATGTTGTTAATAGGGAAGG - Intergenic
1016221344 6:141674012-141674034 TGGGATGTTGATGGTGGGGGAGG + Intergenic
1016430297 6:143977105-143977127 GGGGATGTCGATAATGGAGAAGG - Intronic
1016678462 6:146799688-146799710 GGGGATGTTAATAATGGGGGAGG + Intronic
1017431387 6:154374540-154374562 GAGGATGTTGATGATAAGGAAGG - Intronic
1017768513 6:157626600-157626622 GGAGATGTTGATAATGGGGGAGG - Intronic
1018124498 6:160668855-160668877 TAGAATGATGATGATGGTGATGG + Intergenic
1018289617 6:162278500-162278522 GGGGATGTTGATAATGGAGAGGG + Intronic
1019369618 7:654600-654622 GAGGATGGTGATGATGGTGATGG - Intronic
1019438839 7:1036562-1036584 CAGGGTGTTGATAATGGGGGAGG + Intronic
1020346655 7:7172739-7172761 TGAGATGTTGATAGTGGGGGAGG - Intronic
1020433716 7:8139729-8139751 TAGGATGTTAATAGTGGGAAAGG + Intronic
1020866327 7:13568662-13568684 GGGGATGTTGATAATGAGGGAGG - Intergenic
1020874980 7:13681818-13681840 GGGGATGTTGATAATGGGGGAGG + Intergenic
1021341040 7:19463067-19463089 GGGGATGTTGATAATGGGGGAGG + Intergenic
1021633511 7:22668749-22668771 AATGATGTTGACAATGGAGAGGG - Intergenic
1021717826 7:23474827-23474849 TAAGATGTTGGAAATGGGCAGGG - Intergenic
1022987501 7:35672153-35672175 TGGGATGCTGATAGTGGGGCAGG + Intronic
1023404952 7:39823730-39823752 GAGGACATTGATAATGGGGGAGG - Intergenic
1023633843 7:42189056-42189078 GAGGATGTTGACAGTGGGGGAGG + Intronic
1024035958 7:45507627-45507649 GGGGATGTTGATAATGGGGGAGG - Intergenic
1024144288 7:46496441-46496463 GGGGATGTTGATAATGAGGGAGG + Intergenic
1024549139 7:50546305-50546327 TAGAATGTTGCAAAAGGGGAGGG + Intronic
1025964865 7:66259696-66259718 TAGGATACTGATATTGGGGGAGG - Intronic
1027393651 7:77730332-77730354 GGGGATGTTAATAATGGGGAAGG - Intronic
1027489302 7:78802806-78802828 TGGGATGTTGATAGTGAGGAAGG + Intronic
1027730101 7:81860570-81860592 GAGGATGTGGAGAATAGGGACGG + Intergenic
1027982047 7:85237221-85237243 TGGGATGTTGATAGTGAGGAAGG - Intergenic
1028101209 7:86823303-86823325 TGGGATGCTGAGAATGGGGATGG - Intronic
1028102997 7:86844670-86844692 TAGGATGTTAACAATGGAGATGG + Intronic
1028723003 7:94055449-94055471 GGGGATGTTGATAATGGTGGAGG + Intergenic
1028770188 7:94610418-94610440 GGGGATGTTGATAATGGGGGAGG + Intronic
1029846108 7:103413895-103413917 GGGGATGTTGATAGTGGGGGAGG - Intronic
1029913434 7:104180551-104180573 TAGAATTTTGATATTGGGGAGGG - Intronic
1029920930 7:104262539-104262561 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1030057552 7:105596617-105596639 CAAGATGTTGAAAATGGAGAAGG - Intronic
1030290528 7:107867676-107867698 GGGGATGTTGATAATGGGAGAGG + Intergenic
1030578997 7:111328666-111328688 TGGGATGTTCATAATGCTGAAGG + Intronic
1030779942 7:113587875-113587897 CTGGATGTTGATAGTGGGGAAGG - Intergenic
1030877201 7:114828682-114828704 TGGAAAGTTGATAATGGGGGAGG + Intergenic
1031175347 7:118341742-118341764 AAGGATGTGGAGAATTGGGAAGG + Intergenic
1031249278 7:119358603-119358625 CAGGATGTTGATTGTGGGGAAGG + Intergenic
1031430239 7:121659038-121659060 GAGGATGTTGATAATTGGGATGG - Intergenic
1031542396 7:123010208-123010230 CAGGATGTTGATAATGGGGAAGG + Intergenic
1031695002 7:124840092-124840114 GAGGATGTTGATACTGGAGGAGG - Intronic
1031709280 7:125023939-125023961 TTGGAAGTAGATAATGGTGATGG + Intergenic
1031865074 7:127029950-127029972 TTGAGTGTTGATAATGGGGTAGG - Intronic
1032178446 7:129653379-129653401 CAGGATGTTGATAGTGGGGGAGG - Intronic
1032435025 7:131893617-131893639 TAGGATATAGAAAATGGGGCAGG - Intergenic
1033459680 7:141534171-141534193 TAGAATGTTCATAATGTGAATGG + Intergenic
1033720530 7:144054580-144054602 TTGGTTGGTGATATTGGGGAAGG + Intergenic
1033889229 7:145988327-145988349 AAGGATATGGATAATGGGGGAGG - Intergenic
1033985027 7:147214759-147214781 AAGGATGTTGATAATGGAGGAGG - Intronic
1034609211 7:152349846-152349868 TAGGATGTTGATACTGAAAAAGG + Intronic
1035310745 7:157966822-157966844 GATGATGGTGATAATGGTGATGG - Intronic
1035525823 8:312411-312433 GGGGATGTTGATAATGGGGGAGG - Intergenic
1035963375 8:4162678-4162700 TGGGATGTTGATAGTTGGGGAGG - Intronic
1036008682 8:4695608-4695630 GCGTATGTTGAGAATGGGGAAGG - Intronic
1036064819 8:5368096-5368118 GAAGATGTTGATAATGGGGTAGG + Intergenic
1036457278 8:8920878-8920900 TTGGATGTTGATAGCAGGGAAGG + Intergenic
1036703223 8:11027888-11027910 TGGGATGTTGATAATGGGGGAGG - Intronic
1037120332 8:15277480-15277502 GAGGATGTTGATAATAGGGAAGG + Intergenic
1037687526 8:21155877-21155899 GGGGATGTTGATAGTGTGGAAGG + Intergenic
1038117280 8:24571671-24571693 TGGGATGATGACAGTGGGGATGG + Intergenic
1038419716 8:27425540-27425562 GAGAATGTTGATAGTGGGGGAGG - Intronic
1038473879 8:27848224-27848246 GGGGATGTTGATAATGGGGAAGG - Intergenic
1038477955 8:27881801-27881823 GGGGATGTTGATAATGGGGGAGG - Intronic
1038875878 8:31548478-31548500 TATGATGATGATAATGGTAATGG + Intergenic
1039078465 8:33713392-33713414 AAGGATGGTGATAATAGGGGAGG - Intergenic
1039095794 8:33883569-33883591 TGGGGTGTTGATAATGGCTAGGG + Intergenic
1039333363 8:36563230-36563252 AGGGATGTTGATAATGGGGGAGG + Intergenic
1039940956 8:42090700-42090722 GGGGATGTTTATAATGGGGGAGG + Intergenic
1040004847 8:42611227-42611249 TGGGATGTTGATAATGGGGAAGG + Intergenic
1040416621 8:47201389-47201411 TAAGATGTAGAGGATGGGGAAGG + Intergenic
1040711889 8:50198567-50198589 CAGGAAGTTCATAATAGGGAAGG + Intronic
1041093288 8:54324929-54324951 GGGGGTGTTGATAATGGGGGAGG + Intergenic
1041101107 8:54397185-54397207 CAGGGTGTTGACGATGGGGAAGG - Intergenic
1041180531 8:55243120-55243142 GAGGATGTTGATAAGTGGGGAGG - Intronic
1041339733 8:56831706-56831728 GAGGATGTTGATAATAGAGGAGG + Intergenic
1042127356 8:65551876-65551898 GAGGATGTTGATAGTGGGGGAGG - Intergenic
1042243999 8:66692818-66692840 GCAGATGTTGATAATGGGGGAGG + Intronic
1042427800 8:68669232-68669254 GGGGATGTTGATAATGGGGGAGG + Intronic
1043038801 8:75232549-75232571 GAAGATGTTGATAATGGGGGGGG + Intergenic
1043333379 8:79144522-79144544 TCAGATGTTGATAGTGGGGGTGG - Intergenic
1043486386 8:80702711-80702733 TAGGAAGGAGATACTGGGGATGG + Intronic
1043739710 8:83795363-83795385 GGGCATGTTGATAATGGGGGAGG + Intergenic
1043828883 8:84963743-84963765 AAGGATGTTGATAATGGGACAGG + Intergenic
1043830880 8:84987422-84987444 GAGGATGTTGATAATGGGGGAGG - Intergenic
1043987688 8:86713950-86713972 GGGGATGTTGATAATGGGGAAGG - Intronic
1044130359 8:88515921-88515943 TATGGTGTTGAGAATGGAGAGGG - Intergenic
1044325302 8:90851708-90851730 GGGGATGTTAATAATGGGGCAGG - Intronic
1044718781 8:95125774-95125796 TAGGATGTTGATAGTAGAGGAGG - Intergenic
1044848107 8:96401460-96401482 GAGGATGTTGACAATGGGGGAGG + Intergenic
1045048953 8:98305578-98305600 AATGATGATGATAATGGTGATGG - Intergenic
1045350916 8:101338867-101338889 TGGGATGTTGACAATGGTGGAGG - Intergenic
1045619866 8:103963633-103963655 GAGGAGGTTGATAATGGGAGAGG - Intronic
1045650262 8:104335746-104335768 GGGGATGTTGATATTGGGGGAGG + Intronic
1045992043 8:108319408-108319430 CAGGATTTTGATAGTGGGGGAGG - Intronic
1046120083 8:109835307-109835329 AGGGATGTTGATAATGGAGAAGG - Intergenic
1046141024 8:110092390-110092412 TAGGGTGTTGATAATGGAAATGG + Intergenic
1046883993 8:119342350-119342372 TGGAATGTTGGTAACGGGGAAGG + Intergenic
1047330521 8:123882943-123882965 AGGGATATTGATGATGGGGAAGG + Intronic
1047640650 8:126817978-126818000 GGGGATGTTGATAATGGGGGAGG - Intergenic
1048188682 8:132267864-132267886 GAGGATATTGAGAATGGGGGAGG - Intronic
1048318644 8:133381166-133381188 GGGGATGTTGATAATGGGGGAGG + Intergenic
1048414350 8:134209741-134209763 TGGGATGTTGATAGTGGGGCAGG - Intergenic
1048731684 8:137448984-137449006 TGCGATGTTGATAAAGAGGATGG + Intergenic
1048810722 8:138283657-138283679 GGAGATGTTGATAATGGGGGAGG + Intronic
1048852370 8:138657325-138657347 TAGGAAGTTAATAATAGGAAAGG + Intronic
1048961426 8:139582704-139582726 TAGTATCCTGAGAATGGGGAGGG - Intergenic
1049264192 8:141658335-141658357 GATGATGGTGATAATGGTGATGG - Intergenic
1049938573 9:523154-523176 TCGGGTGTAGATACTGGGGAAGG - Intronic
1050011270 9:1187754-1187776 GAGGATGTTGATAACGGGAGAGG - Intergenic
1050111386 9:2220166-2220188 GAAGATGTTGATAATGAGGCAGG - Intergenic
1050145629 9:2564378-2564400 AGGGATGTTGATAATGGGTGAGG + Intergenic
1050196768 9:3093093-3093115 GGGGATGTTGATAATGGGTGAGG + Intergenic
1050212516 9:3277976-3277998 GAGGATGTTGATAATTGTCATGG - Intronic
1050567266 9:6899258-6899280 AAGGATATTGATAATGTGGGGGG - Intronic
1050777353 9:9282286-9282308 GGGGATGTTGATAATGGGGCAGG + Intronic
1050804517 9:9656826-9656848 GGGGATGTTGATAGTGGGAAAGG + Intronic
1050824518 9:9929362-9929384 TTGAAACTTGATAATGGGGAGGG + Intronic
1050847241 9:10237141-10237163 GGGGATGTTGATAATGGGTGAGG + Intronic
1050998296 9:12247426-12247448 GGGGATGTTGATAATAGTGAAGG - Intergenic
1051442178 9:17097087-17097109 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1051746710 9:20301676-20301698 GGGGATGTTGATAATGGAGGAGG - Intergenic
1051906267 9:22098113-22098135 CAGAATGTTGATAATGTAGATGG + Intergenic
1052068020 9:24046899-24046921 TAAGATAGTTATAATGGGGACGG + Intergenic
1052130587 9:24841406-24841428 TAGGACGTGGATAATGGGAGAGG - Intergenic
1052139486 9:24961409-24961431 GAGGATGTTGATAACGGGGGAGG + Intergenic
1052520802 9:29546603-29546625 TAGGATGTGAAAAAGGGGGATGG - Intergenic
1052902493 9:33805527-33805549 TAGGATGTTGACAGTCGGGGAGG - Intergenic
1053040846 9:34870143-34870165 CAGGATGTTGATAGTGGGGAAGG - Intergenic
1053410166 9:37911070-37911092 GAGGATGCTGAGAAAGGGGATGG + Intronic
1054853196 9:69870607-69870629 TAGGATGAAGATCCTGGGGAGGG - Intronic
1055092244 9:72374784-72374806 TGGGATGTTGATAATGGGGAAGG + Intergenic
1055449634 9:76419192-76419214 TAAGATGGTGATGATTGGGATGG - Intergenic
1055527018 9:77145198-77145220 GGGGATGTTGATAGTGGGGAAGG + Intergenic
1055538630 9:77277361-77277383 GAGGATGTTGATAATGAAAAAGG - Intronic
1055743458 9:79415699-79415721 CAGGATGTTGATACTGGAGGAGG + Intergenic
1055781512 9:79826278-79826300 GAGGATGCTCATAATGGGGGAGG + Intergenic
1055793524 9:79949306-79949328 TTGAATGTAGATAGTGGGGATGG + Intergenic
1055850459 9:80621957-80621979 GAGGATATTGATAATAGGGGAGG + Intergenic
1055931997 9:81568628-81568650 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1055992943 9:82127664-82127686 TGGGATGTTGATAGAGAGGAAGG + Intergenic
1056084345 9:83130347-83130369 TGGGATGTTGATAATTGGGGAGG - Intergenic
1056096927 9:83264520-83264542 TGGGATGTTGATGATGGGGGAGG + Intronic
1056104280 9:83331648-83331670 AAGGATATTGATAATGAGGGAGG + Intronic
1056212443 9:84377238-84377260 GGGGATGTTGATAATGAGGGAGG - Intergenic
1056701467 9:88914634-88914656 TGGGATGTTGATAGTGGGGGAGG + Intergenic
1056844885 9:90029095-90029117 GGAGATGTTGATAATGGGGAAGG + Intergenic
1056921935 9:90798884-90798906 GGGGCTGTTGATAATGGGAAAGG - Intergenic
1057309981 9:93936269-93936291 GGGGATGCTGATTATGGGGAAGG + Intergenic
1057436206 9:95042897-95042919 GAGGATGTTGATAATGTAAAGGG + Intronic
1057514094 9:95706053-95706075 GATGATGATGATAATGGTGATGG - Intergenic
1057858687 9:98623009-98623031 GGGGATGTTGATAATGGGGGAGG + Intronic
1058863801 9:109143377-109143399 CAGGATGTTGATAATGGGGGAGG + Intronic
1059090671 9:111354638-111354660 CAGGATGTTGATAGTGGGCGAGG + Intergenic
1059892711 9:118821910-118821932 CAGGATATTGATAGTGGGGTAGG - Intergenic
1060111069 9:120906586-120906608 GGGGATGTTGATAGTGGGGGAGG - Intronic
1060196471 9:121626985-121627007 CAGGATGTTGATGGTGGGGGAGG - Intronic
1060371621 9:123078819-123078841 TAGGATGTTAATAATGAAGGTGG - Intronic
1185852362 X:3500986-3501008 GGGGATATTGATAATGGGGGAGG + Intergenic
1186098856 X:6133188-6133210 TATGATGGTGATGATGAGGATGG - Intronic
1186131648 X:6473122-6473144 TGTGATGATGATAATGGTGATGG + Intergenic
1186167356 X:6840810-6840832 GGGGATGTTGGTAATGGGGATGG + Intergenic
1186248233 X:7637663-7637685 GAGGATGTTAATAATGGGGGAGG - Intergenic
1186359120 X:8821107-8821129 TGGGATGATGACAATGGTGATGG - Intergenic
1186593906 X:10960254-10960276 TAGCATGTTGATGTTGGGGCAGG - Intergenic
1186695617 X:12028413-12028435 TGAGATGCTGATAATGGCGAAGG - Intergenic
1186960402 X:14730412-14730434 AAAGATGTTGAAAATGAGGAAGG - Exonic
1187128143 X:16473676-16473698 TGGGATGTTGGTAATGGAGGAGG + Intergenic
1187148102 X:16656100-16656122 TAGGAGGTTGATAATGGCTTAGG - Intronic
1187783287 X:22854258-22854280 AGGGATGTTGATAGTGGGGGAGG + Intergenic
1187863220 X:23701233-23701255 TGGGAGGTGGCTAATGGGGAGGG - Intergenic
1187909731 X:24100348-24100370 TAGGATGTGGATATTTTGGAGGG + Intergenic
1187934174 X:24319790-24319812 TGGGATGTTGATAGTTGGGGAGG - Intergenic
1188104186 X:26129075-26129097 TAGGATGGTGACATTGGAGATGG - Intergenic
1188269050 X:28116092-28116114 GGGGATGTTGATAATGGGGGAGG - Intergenic
1188400006 X:29732576-29732598 AAGGATGTTCATTATGTGGAAGG - Intronic
1188502194 X:30839650-30839672 TAGGATGCTGATAATGGGGCAGG + Intronic
1188622165 X:32239456-32239478 TGGGATGTTGATAGCGGGGTAGG - Intronic
1188954959 X:36423028-36423050 TAGAAATTTTATAATGGGGAAGG + Intergenic
1189027559 X:37413074-37413096 AGGGATGTTGATAATGGGAAGGG - Intronic
1189236883 X:39494101-39494123 TGGGATGATGATATTGGAGATGG - Intergenic
1189464969 X:41271638-41271660 GGGGATATTGATAATGGGGGAGG + Intergenic
1189729289 X:44002010-44002032 CTGGATGTTGATAGTGGGGGAGG + Intergenic
1189937545 X:46085581-46085603 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1189941778 X:46131158-46131180 TAGGATGCTGAGATTGAGGAAGG + Intergenic
1190625346 X:52332022-52332044 AGGGATATTGATAATTGGGAAGG - Intergenic
1190899944 X:54661819-54661841 GAGGATATTGATAATGGGAGAGG - Intergenic
1192187645 X:68962863-68962885 GGGGATGTTGATAATGGGGGAGG - Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1192903643 X:75525670-75525692 GGGGATGTTGATAATGGAGGTGG - Intergenic
1193681381 X:84523282-84523304 AAGGATGTTGAAAATAGGGGAGG - Intergenic
1193849962 X:86524827-86524849 TAGGATGTTGGTGATGGTGATGG + Intronic
1194184444 X:90756510-90756532 GGGGATATTGATAATGGGGGAGG + Intergenic
1194369216 X:93050065-93050087 CAGGATGTTGATAGTGAGGGAGG - Intergenic
1194992476 X:100559623-100559645 TGGGATTTTGACAGTGGGGAAGG + Intergenic
1195583567 X:106535784-106535806 TAGGATGTGGAGATTTGGGAGGG - Intergenic
1195587481 X:106581812-106581834 GAGGATGTTGATAATGGGTGAGG + Intergenic
1195680342 X:107541188-107541210 TACAATGTTGAGAATTGGGAAGG - Intronic
1195943462 X:110184117-110184139 CAGGATGTTGATAGTGGGGTAGG + Intergenic
1195952704 X:110292902-110292924 TGGGGTGTTGTTAATGGGGGAGG + Intronic
1196016874 X:110948987-110949009 TTGGATGATGAAAATGAGGATGG + Intronic
1197052019 X:122071252-122071274 TAGGGGGTTGGGAATGGGGATGG - Intergenic
1197241182 X:124124907-124124929 GGGGATGTTGATAATGGGAAGGG + Intronic
1197640978 X:128967805-128967827 GATGATGTTGATAATGGTGGTGG + Intergenic
1198255587 X:134921649-134921671 GAGGCTGTTGATAATGGGGGAGG + Intergenic
1198502376 X:137264252-137264274 GAGGATGTTGATAATGGGGGAGG + Intergenic
1198526671 X:137508414-137508436 TATCATTTTGATAATGGGTATGG - Intergenic
1198786479 X:140294237-140294259 GGGGATATTGATAATGTGGAAGG - Intergenic
1199088090 X:143652623-143652645 GAGGATGTTGATAAAGGGGAAGG - Intergenic
1199498839 X:148486676-148486698 GAGGATGTTGATAATGGGGAAGG + Intergenic
1199689921 X:150301509-150301531 TAGGATATTGATAGTGAGGAAGG - Intergenic
1200531033 Y:4338423-4338445 GGGGATATTGATAATGGGGGAGG + Intergenic
1201143612 Y:11048829-11048851 GATGATGTTGGTGATGGGGATGG + Intergenic
1201501302 Y:14645807-14645829 TATGATGGTGATGATGAGGATGG + Intronic
1201959073 Y:19659154-19659176 TCAGATGTTGCCAATGGGGATGG - Intergenic