ID: 902071930

View in Genome Browser
Species Human (GRCh38)
Location 1:13747689-13747711
Sequence GGGGCTTTATCTAGACTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902071930 Original CRISPR GGGGCTTTATCTAGACTAGA AGG Intronic
902071930 1:13747689-13747711 GGGGCTTTATCTAGACTAGAAGG + Intronic
912366036 1:109134656-109134678 AGGGCTTTATCTACACAAGCAGG - Intronic
912762479 1:112381507-112381529 GGTATTTTATCTAGACTGGAAGG + Intergenic
918011123 1:180587320-180587342 GGAGCCTTAACTAGACCAGAAGG + Intergenic
918973975 1:191456741-191456763 GGGCCTTTATGAGGACTAGAAGG + Intergenic
922024555 1:221738627-221738649 GGGGCTTTATACACACCAGATGG - Intronic
923290735 1:232543051-232543073 GAGGCTTAATCTGTACTAGAAGG + Intronic
923314676 1:232768263-232768285 TGGGCTTCTGCTAGACTAGAGGG - Intergenic
1066129823 10:32381890-32381912 GGGGCTTAACCTAGGCTTGAAGG + Intergenic
1068442959 10:57083190-57083212 GGGGCTATTTCTAGATTAGGAGG + Intergenic
1072423661 10:95310841-95310863 GTTGCTCTGTCTAGACTAGAGGG + Intergenic
1072428211 10:95348125-95348147 GTGGCTTTAACTAGATTATAAGG - Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1074895086 10:117770396-117770418 GGGTTTTCATCTAGTCTAGATGG + Intergenic
1081739427 11:45427772-45427794 GGGCCTTCATGCAGACTAGAAGG - Intergenic
1082942418 11:58721757-58721779 GGGGCTTTATTTACATTATAAGG - Intronic
1088879547 11:113962812-113962834 GGAGATTTATGTAGACTTGAAGG + Intergenic
1091922959 12:4320668-4320690 GAGGCCTTTTCTATACTAGACGG - Intergenic
1093244382 12:16718244-16718266 AAGGCTTTCCCTAGACTAGAGGG - Intergenic
1094377219 12:29802639-29802661 GGGGCTTTAGCCAGACTGCAAGG + Intergenic
1097919103 12:65052590-65052612 GGGGGTTTATTTTGACTAGACGG - Intronic
1101849978 12:108394085-108394107 GGTGCTTTCTATAGAATAGATGG - Intergenic
1108792121 13:53982932-53982954 GGTGCTTTATCTGGAGAAGAGGG + Intergenic
1117043858 14:51792477-51792499 GGGACTTTCTCTAGAATACATGG + Intergenic
1131427363 15:92356535-92356557 GGAGCTTTCTCTAAACAAGAGGG + Intergenic
1138335596 16:56250367-56250389 GTGGCTTTATCTAGTCTAATTGG - Intronic
1138852758 16:60649955-60649977 AGGACTTTCTCTAGGCTAGAGGG - Intergenic
1140112423 16:72015408-72015430 AGGGCTTTATACAGTCTAGAAGG - Intronic
1147184986 17:38708345-38708367 GGGGCTTACTTTAGACCAGATGG + Intronic
1148724486 17:49778916-49778938 GGGCCTTGATCTAGCCTGGAGGG + Intronic
1148950125 17:51303400-51303422 GGGGCTTTATTTACATAAGAAGG + Intergenic
1165326139 19:35115570-35115592 GGGGCCTTATGTGGACTAGGAGG + Intergenic
1165715967 19:38046137-38046159 GGAGCTTTCTATAGACGAGAAGG + Intronic
1167906176 19:52662622-52662644 GTGGCTTTTTCTATACGAGATGG - Intronic
925479655 2:4255939-4255961 GGACCTTTCTCTAGGCTAGAGGG - Intergenic
927479158 2:23437007-23437029 GGAGCTTTTTCTACACTGGATGG - Intronic
929565245 2:42979811-42979833 GAGGGTTTATCTGGTCTAGAGGG + Intergenic
933780087 2:85795307-85795329 GGAGCTTTATCCAGATTTGAAGG - Intergenic
945489707 2:210440907-210440929 GGGACTGTATTTAGCCTAGAAGG + Intronic
1173121223 20:40291306-40291328 GTGGCTATATCTAGACTCAATGG + Intergenic
1176100689 20:63363123-63363145 GGGGCTTCATGTAGGCCAGAAGG - Intronic
1184734179 22:46388485-46388507 GCGGCCTTATGCAGACTAGAAGG + Intronic
953011332 3:39028037-39028059 AGGGTTTTCTGTAGACTAGATGG - Intergenic
956455325 3:69415260-69415282 GGGGCTTTATCTCCATTTGATGG - Intronic
957269829 3:78015327-78015349 GGGGCTTTCCCTAGAGTGGATGG + Intergenic
957547601 3:81660378-81660400 TTGGCTTTATCTACACAAGATGG - Intronic
957857784 3:85900211-85900233 GTTACTTCATCTAGACTAGAAGG + Intronic
960533679 3:118793441-118793463 GGGGCCTGACCTAGACTGGAGGG - Intergenic
962052179 3:131828070-131828092 GTGGCTTTTTCTAGACAATAGGG - Intronic
966557441 3:181278883-181278905 GGGGCTTTAAATACACTAGGGGG - Intergenic
966624939 3:182005687-182005709 GGGGCTTTATGGAGACCTGAGGG + Intergenic
981159134 4:141476013-141476035 GAGGCTTTATCGTGGCTAGAAGG - Intergenic
981943320 4:150310870-150310892 GGGTCTTTAATTTGACTAGATGG + Intronic
982085456 4:151831064-151831086 GGGGATTGATCTAGAGAAGAGGG + Intergenic
985115872 4:186590093-186590115 GGTGCTTTATATAGTCTAAAAGG - Intronic
986507329 5:8466040-8466062 GGGGCTTGCTCTAGATTGGAGGG - Intergenic
995520975 5:113005008-113005030 CGGGCTCTATCTAGAGTAGCTGG - Intronic
998179711 5:139927988-139928010 GGGGCTTTTTCTAGAGTAAGAGG - Intronic
999592328 5:153161795-153161817 GGGGCTTTATCTTAGCTAAATGG - Intergenic
1003753406 6:9088226-9088248 TGGGCTTTCTCTAAACTAGTAGG - Intergenic
1009871845 6:69462383-69462405 ATGTCTTTATTTAGACTAGATGG + Intergenic
1010924131 6:81722692-81722714 GGGCTTTTATCTTGACTAGCAGG - Intronic
1016225665 6:141733275-141733297 GGAGGTTTATCTAGACTCTATGG - Intergenic
1022065524 7:26851780-26851802 GGGAGATTATCTAGAGTAGAAGG + Intronic
1024111095 7:46146802-46146824 ATGGCTTTAACTAGACTGGAAGG + Intergenic
1026397083 7:69966332-69966354 GTGGCTTTATCATGACCAGAAGG - Intronic
1033289288 7:140069438-140069460 GGGGCCTTCTCGACACTAGAAGG + Intergenic
1038687788 8:29734260-29734282 GGGGCTTGAGCTAAAGTAGAGGG - Intergenic
1039934420 8:42028979-42029001 GGGAATTTATCAACACTAGATGG - Intronic
1042785758 8:72545186-72545208 GGGGCCATATCCAGACTAAATGG - Intronic
1059650513 9:116312052-116312074 AGGGTTTTATCTAGTCTACATGG - Intronic
1187564440 X:20434493-20434515 GGGTCTAGATCTAGAATAGATGG + Intergenic
1192831295 X:74753411-74753433 GGGGATATTTCTGGACTAGAAGG - Intronic
1199101227 X:143802815-143802837 GGGACTTTACCTAGACCAGGAGG + Intergenic
1199273364 X:145912394-145912416 GTGGCTTCATCTAGAGAAGAAGG + Intergenic