ID: 902078824

View in Genome Browser
Species Human (GRCh38)
Location 1:13807087-13807109
Sequence TATTCAGCCCCCAGTGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902078824_902078835 28 Left 902078824 1:13807087-13807109 CCAAAACCACTGGGGGCTGAATA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 902078835 1:13807138-13807160 CCTGAGTCTTGGCCTCGTACGGG 0: 1
1: 0
2: 0
3: 4
4: 78
902078824_902078829 2 Left 902078824 1:13807087-13807109 CCAAAACCACTGGGGGCTGAATA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 902078829 1:13807112-13807134 AATGTGGTCATTTGGGAGCCAGG 0: 1
1: 0
2: 4
3: 22
4: 214
902078824_902078831 17 Left 902078824 1:13807087-13807109 CCAAAACCACTGGGGGCTGAATA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 902078831 1:13807127-13807149 GAGCCAGGAGGCCTGAGTCTTGG 0: 1
1: 0
2: 1
3: 51
4: 442
902078824_902078827 -6 Left 902078824 1:13807087-13807109 CCAAAACCACTGGGGGCTGAATA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 902078827 1:13807104-13807126 TGAATAAGAATGTGGTCATTTGG 0: 1
1: 0
2: 1
3: 24
4: 321
902078824_902078828 -5 Left 902078824 1:13807087-13807109 CCAAAACCACTGGGGGCTGAATA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 902078828 1:13807105-13807127 GAATAAGAATGTGGTCATTTGGG 0: 1
1: 0
2: 4
3: 33
4: 337
902078824_902078833 27 Left 902078824 1:13807087-13807109 CCAAAACCACTGGGGGCTGAATA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 902078833 1:13807137-13807159 GCCTGAGTCTTGGCCTCGTACGG 0: 1
1: 0
2: 0
3: 3
4: 76
902078824_902078830 5 Left 902078824 1:13807087-13807109 CCAAAACCACTGGGGGCTGAATA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 902078830 1:13807115-13807137 GTGGTCATTTGGGAGCCAGGAGG 0: 1
1: 1
2: 3
3: 10
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902078824 Original CRISPR TATTCAGCCCCCAGTGGTTT TGG (reversed) Intronic
901124419 1:6919009-6919031 AATGAAGCCCACAGTGGTTTTGG + Intronic
902078824 1:13807087-13807109 TATTCAGCCCCCAGTGGTTTTGG - Intronic
903577353 1:24347028-24347050 GCTACAGCCCCCAGAGGTTTGGG - Intronic
908753536 1:67447036-67447058 TGTTCAGCCCCCAGAGAATTAGG + Intergenic
911231079 1:95362378-95362400 AATTCAGCCCGCTGTGGTCTGGG - Intergenic
911244348 1:95500301-95500323 TAGTCAGGCCCTTGTGGTTTTGG + Intergenic
911836631 1:102627517-102627539 TATTCAGGAGCCAGTGGATTTGG - Intergenic
919282028 1:195502755-195502777 TATCCAGCCCCCGTTGGTTGGGG - Intergenic
919834914 1:201566998-201567020 AAGTCAGCACCCTGTGGTTTGGG - Intergenic
920154500 1:203937534-203937556 GCTTCAGCCCCCAGAGGTTGAGG + Intergenic
922678452 1:227568825-227568847 TATTGAGCAACCAGTGGTGTTGG + Intronic
1066509717 10:36083124-36083146 TCTTCAGCCCCCAGTCAGTTTGG + Intergenic
1068826674 10:61447866-61447888 TCTGAAGGCCCCAGTGGTTTGGG - Intronic
1070346469 10:75547508-75547530 TATTGTGGCCACAGTGGTTTTGG - Intronic
1070425211 10:76280544-76280566 TATTCAGCCCCTGTTTGTTTGGG + Intronic
1071451635 10:85797583-85797605 GATTTAGCCCCCAGTGGGTGTGG - Intronic
1072548235 10:96456999-96457021 TTTTCTGACCCCAGTGGTTTTGG + Intronic
1073222571 10:101888007-101888029 TATTCATCCCCCAGCAGCTTGGG - Intronic
1075239567 10:120765548-120765570 GATTCAACCCACAGGGGTTTTGG + Intergenic
1075367140 10:121901865-121901887 TATTATGCCCAAAGTGGTTTTGG + Intronic
1079979990 11:27140908-27140930 TAGCCAGCCCACAGTGGTTGCGG - Intergenic
1080035536 11:27706139-27706161 TAATCAGTCCCCAGTTATTTCGG + Intronic
1081966806 11:47175118-47175140 TATTCAGAGCCCTGTGTTTTAGG - Intronic
1085466092 11:76724255-76724277 TGTTCAGACCCCAGTGCTCTGGG + Intergenic
1098144436 12:67484440-67484462 TATTCAGCTCCCTGTGGTCAGGG - Intergenic
1099149272 12:79088713-79088735 TATTCAGATCACAGTGGCTTTGG + Intronic
1100128532 12:91460676-91460698 GATTCTACCCCCAGTGATTTAGG - Intergenic
1103523050 12:121549079-121549101 TATTGAGCCCACAGTAGATTGGG - Intronic
1108165785 13:47691902-47691924 AATGCAACCCCCAGTGATTTGGG - Intergenic
1108562156 13:51654570-51654592 TATTAAGCCCGCAGAGGTTAGGG - Intronic
1111567283 13:90032633-90032655 TGCTCAGCCTCCAGTTGTTTGGG + Intergenic
1114368149 14:22052866-22052888 TTTACAACCTCCAGTGGTTTAGG + Intergenic
1114785025 14:25586281-25586303 TCTTCAGCTCCCAGTGAGTTTGG - Intergenic
1117458115 14:55918092-55918114 TCCACAGCCCCCAGTGGTTGCGG - Intergenic
1119230240 14:72973760-72973782 TATTCAGCTCCAAGTGGCATTGG - Intronic
1119888713 14:78166135-78166157 AATTCAGCCCCCAGTGCTATTGG - Intergenic
1125419382 15:39488888-39488910 TACTCAGCACCCAGTGAGTTGGG - Intergenic
1126851644 15:52800809-52800831 AATCCAGCCCACAGAGGTTTCGG - Intergenic
1134851930 16:17485831-17485853 GATTCAAACCCAAGTGGTTTGGG - Intergenic
1137860638 16:51843116-51843138 TATGCAGGCCCCAGTGCTGTGGG + Intergenic
1140063896 16:71593763-71593785 CCTTCAGCCCCCAGTTGATTAGG + Intergenic
1141257783 16:82418907-82418929 TACTACTCCCCCAGTGGTTTGGG + Intergenic
1141588425 16:85050657-85050679 GAGTCAGCCCCCAGGGGATTGGG - Intronic
1141647900 16:85377300-85377322 TGCACAGCCCCCAGTGGTTCGGG + Intergenic
1149674407 17:58446604-58446626 TAGTCAGCCCACAGTGGATCAGG - Intronic
1149971477 17:61222699-61222721 CATTCAGCAACCAGTGGTCTTGG + Intronic
1154112795 18:11584942-11584964 TATTTAGTCCTCAGTGATTTCGG - Intergenic
1158492271 18:57920963-57920985 AATGAAGCCCCCAGTGCTTTTGG - Intergenic
1161129862 19:2581435-2581457 TTCTCACCCCCCTGTGGTTTGGG - Intronic
1161315575 19:3615772-3615794 TATCCAGTCCCCTGTGGTGTAGG - Intronic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
926046405 2:9712678-9712700 TCGTGAGCCCACAGTGGTTTGGG - Intergenic
927309102 2:21608327-21608349 TATTCCGTCCCCAATGGTTGTGG + Intergenic
931938784 2:67229193-67229215 TATTTGGCCCCCAGTGAATTGGG + Intergenic
932246757 2:70202873-70202895 TCTGCATCCCCGAGTGGTTTTGG + Intronic
932618779 2:73253450-73253472 AGTTCAGCCCCCAGTGATCTTGG + Intergenic
936665706 2:114593119-114593141 TAGGCTGCCTCCAGTGGTTTGGG - Intronic
937863696 2:126732436-126732458 TATTCTGCTCCCACTGGTGTGGG - Intergenic
939008857 2:136821496-136821518 AACTCAGCCACCAGTTGTTTAGG - Intronic
939204382 2:139081190-139081212 TATTCAGACCTCAATGGATTGGG + Intergenic
939410760 2:141821752-141821774 TATTAAGCACCAAGTGTTTTTGG + Intronic
942451831 2:176112872-176112894 TCTTCAGCCCCCAGAGGTTCTGG - Intronic
946539242 2:220665756-220665778 AATACAGCCCCCAGTGGTGTGGG - Intergenic
948702073 2:239766801-239766823 TATTCAGCCACCAAAGGTATGGG - Intronic
1169255085 20:4091118-4091140 CACCCAGCCCCCAGTGGCTTTGG - Intergenic
1171423998 20:25038322-25038344 AGTTCAGGCCCCAGTGGTGTGGG - Intronic
1176914525 21:14608844-14608866 TATTCACCCCCAAGTGTTATTGG - Intronic
1178148926 21:29771673-29771695 TATCCAGCCCACACTGGCTTGGG - Intronic
1178311204 21:31531363-31531385 TAGGCAGCCCCCAGGGGTTGCGG - Intronic
1179256685 21:39722577-39722599 TATTAAGCCCCCAGTATTTTGGG + Intergenic
1179898905 21:44378797-44378819 TGTGCAGCCCCCAGTGTGTTGGG + Intronic
1182004422 22:26947551-26947573 TATGGAGCTCACAGTGGTTTGGG + Intergenic
1183160584 22:36110489-36110511 TATTCCTCCCCCAGTGGCTGGGG + Intergenic
1184562697 22:45272626-45272648 GATCCACCCCCAAGTGGTTTTGG - Intergenic
950797817 3:15524675-15524697 CATTCACTACCCAGTGGTTTAGG + Intergenic
953342580 3:42147873-42147895 TCTTCAGCTTCCAGTGATTTAGG + Intronic
955643592 3:61112714-61112736 TATTCAGGGACCAGTGGTTATGG + Intronic
956185862 3:66561234-66561256 AATTCAGCCCCGTGTGGTGTCGG + Intergenic
956196428 3:66657466-66657488 TATTAAGTGCCCACTGGTTTTGG + Intergenic
964454095 3:156841874-156841896 TAGTCAGCGGCCAGGGGTTTGGG - Intronic
966916603 3:184587722-184587744 TCTTCAGCCCCCAGTAGTCAGGG - Intronic
967574849 3:191077456-191077478 CCTTCAGTCCCCAGTTGTTTTGG - Intergenic
968555924 4:1246421-1246443 TCTCCAGCCCCCAGTGGAGTGGG + Intronic
974642232 4:64646054-64646076 TCTTCAGCTGCCAGTAGTTTTGG - Intergenic
975151499 4:71027372-71027394 TAGTCAACTCCCAGTGATTTGGG - Intronic
980497173 4:133601079-133601101 AATTCAACCCCCAATGGGTTTGG - Intergenic
981888819 4:149712749-149712771 AATTCTGCCCCCAGTCATTTTGG + Intergenic
984961958 4:185106329-185106351 TTTCCAGCCCGCAGTGATTTAGG - Intergenic
985681426 5:1257867-1257889 CATTCAGCTCCCAGTGGCTCGGG + Intronic
991458815 5:66834641-66834663 TGTTCAGGCCCCAGTGATGTAGG - Intronic
994724671 5:103420543-103420565 TATTCTGCCCTAAGTGTTTTTGG + Intergenic
997162266 5:131621540-131621562 ACTTCAGCCCCCAATGTTTTGGG + Intronic
1001416107 5:171545677-171545699 TGTTCAGGCCCAAGTGGTCTGGG + Intergenic
1004714716 6:18206116-18206138 TATTAACCCCACAGTGGTTTTGG + Intronic
1007901557 6:45419005-45419027 TATGCAGTCCTCAGTGGTTGGGG - Intronic
1008472967 6:51904447-51904469 TATTCCAACCTCAGTGGTTTGGG - Intronic
1017739267 6:157392434-157392456 TATACAGCCCCCCGTGTGTTGGG + Intronic
1024369326 7:48562005-48562027 TAAGCAGCCCCCAGTGTTTGAGG + Intronic
1024447005 7:49492439-49492461 TAATCAACCCCAAGTGGGTTAGG - Intergenic
1028645067 7:93086735-93086757 TGTTCAGGCACCAGTGGTTGTGG + Intergenic
1029223264 7:99006980-99007002 GACTCAGACCACAGTGGTTTCGG + Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1043931221 8:86093712-86093734 AATTGAGCCCCCAGAGGTTGAGG - Intronic
1046700772 8:117398262-117398284 TATCAAGCCCACAGTGGATTGGG - Intergenic
1048590519 8:135816878-135816900 TATTTAGGCCCCAGTGGATTGGG - Intergenic
1048823654 8:138402148-138402170 TTCTAAGCCCCCAGTGATTTTGG - Intronic
1055142795 9:72895271-72895293 TATTCTGCACTCAGTGGTCTTGG - Intergenic
1055149014 9:72972691-72972713 TATTCTACCCACAGTGGCTTAGG + Intronic
1061606938 9:131717847-131717869 TATTCTGGGCCCAGTGGTTAGGG + Intronic
1185860590 X:3575431-3575453 AATTGAGCCCCCAGAGGTTGAGG - Intergenic
1187774534 X:22740778-22740800 TATTCAGTCACCTGTGATTTGGG - Intergenic
1192430644 X:71109237-71109259 TATTGCTCCCCCAGTGGATTGGG + Exonic
1193933090 X:87581309-87581331 TCTTCAGCCCCCAATTGGTTTGG - Intronic
1201768531 Y:17595587-17595609 TACTCAGCCACCTATGGTTTAGG - Intergenic
1201833023 Y:18310398-18310420 TACTCAGCCACCTATGGTTTAGG + Intergenic