ID: 902079151

View in Genome Browser
Species Human (GRCh38)
Location 1:13809302-13809324
Sequence AGTGAGAAGTCCAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902079142_902079151 21 Left 902079142 1:13809258-13809280 CCGTCACACTTCTGTGGAACAGA 0: 1
1: 0
2: 2
3: 15
4: 206
Right 902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG 0: 1
1: 0
2: 4
3: 37
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902079151 Original CRISPR AGTGAGAAGTCCAGTGAGGA AGG Intronic
900166718 1:1246900-1246922 AGTGAGGAGGCCAGAGAGGACGG - Intergenic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902453548 1:16514909-16514931 AGTGATAAAACCAGTAAGGAAGG - Intergenic
902464483 1:16607642-16607664 GGAGAGAAGTCCATTGAGAAAGG - Intronic
902473603 1:16667571-16667593 AGTGATAAAACCAGTAAGGACGG - Intergenic
902485200 1:16739871-16739893 AGTGATAAAACCAGTAAGGACGG + Intergenic
902498934 1:16895346-16895368 AGTGATAAAACCAGTAAGGAAGG + Intronic
902882646 1:19382937-19382959 AGAGAGAAGTCCAGTGAAGATGG - Intronic
903123350 1:21231244-21231266 AGTGAGGAGTGCAGTGAGATGGG + Intronic
903156328 1:21446064-21446086 GGAGAGAAGTCCAGTGAGAAAGG + Intronic
903740147 1:25554064-25554086 AGTGAGCACCCCAGTCAGGAAGG + Exonic
904290520 1:29482813-29482835 AGCAAGAAGACCAGGGAGGAAGG - Intergenic
905305128 1:37012538-37012560 AGTCAGAAGGCCAGAGTGGAAGG + Intronic
905522469 1:38610950-38610972 AGAGAGAAGTCCAGTGCGCCTGG + Intergenic
905924992 1:41743252-41743274 AGTGAGAACTCCTGTGAAAAGGG + Intronic
906019116 1:42611356-42611378 AGTGTGAAGGCAAGTGAGAAGGG - Intronic
906721090 1:48005327-48005349 AGAGAGAAGTCCAGTGAACCTGG + Intergenic
907178545 1:52549336-52549358 AGTGAGAAATTCAGTGTGGTAGG - Intronic
907247305 1:53116344-53116366 AGTCCGCAGTCCAGTGAGGTGGG - Intronic
907255035 1:53172809-53172831 GGTGAGAATTCCATTGTGGATGG - Intergenic
908247330 1:62238220-62238242 AGGGAGGAGTCCAGAGAAGAAGG + Exonic
909715561 1:78702534-78702556 AGTGTGGAGCCCAGTGAGGTTGG - Intergenic
910504787 1:87937624-87937646 AGGGGGAAGTGCAGTGAGGAAGG + Intergenic
911370558 1:96989676-96989698 AGAGAAGGGTCCAGTGAGGAGGG + Intergenic
911420679 1:97636883-97636905 AGTAAGAAATCCTGTGAGCATGG + Intronic
912552969 1:110496383-110496405 AGAGAGATGTCCAGTGAGTGAGG - Intergenic
912911965 1:113770407-113770429 ATCGAGAAGTCCAGAGAGGTTGG - Intronic
912973931 1:114310822-114310844 AGTGAGAAGACAAGAGGGGAAGG + Intergenic
913228010 1:116717536-116717558 AGTGAGAAGTACAAGGAGGTGGG - Intergenic
913264105 1:117027620-117027642 AGAGATGAGACCAGTGAGGAGGG + Intronic
913993233 1:143634639-143634661 GGAGAGAAGTCCATTGAGAATGG - Intergenic
914005667 1:143730214-143730236 AGTGATAAAACCAGTAAGGAAGG - Intergenic
914098133 1:144561460-144561482 AGTGATAAAACCAGTAAGGAAGG - Intergenic
914300848 1:146376156-146376178 AGTGATAAAACCAGTAAGGAAGG + Intergenic
915023878 1:152807885-152807907 AGTGAGAATTCCAATGATGATGG - Intronic
915603172 1:156935243-156935265 GATGAGAAGTCCAGGGAGGGAGG + Exonic
916009595 1:160692687-160692709 ATTGAGAAGTCAAGAAAGGAAGG + Intronic
916975783 1:170075893-170075915 AATAGGAAGTCCAATGAGGAAGG - Intronic
917603775 1:176604022-176604044 AGTCAGAAGGCCAGTGTGGCTGG - Intronic
918432563 1:184477201-184477223 AGTGGGAAATCAAGTGAGAATGG + Intronic
919098938 1:193069883-193069905 GGTGAGCATTCCAGTTAGGACGG - Intronic
919148004 1:193659428-193659450 AGTGAGAAGGCCTGGGAGCAGGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920816989 1:209343983-209344005 AGTGGGAAATCCAGTGGGGGAGG - Intergenic
921224608 1:213005805-213005827 AGTGAGGAGGCCAGTGAGATTGG - Intronic
921281106 1:213569040-213569062 AGTGGGAAGTACACTGGGGAGGG - Intergenic
921326477 1:213989570-213989592 ACTGGGAAGACTAGTGAGGAGGG + Intronic
921616791 1:217277727-217277749 AATGAGAAGTGCAGTGTGAAGGG - Intergenic
921794339 1:219325652-219325674 GGTGAGAAGTGAAGTGATGAAGG - Intergenic
921840744 1:219825722-219825744 AGGGAGAAGGCCAGAGAGGTGGG + Intronic
921889625 1:220340653-220340675 AGTGAGAAGATCTGTGATGATGG + Intergenic
922055340 1:222037188-222037210 AGCGGGAAGACCAGTGAGGGAGG + Intergenic
922343294 1:224674755-224674777 ACCGAGAAGTCCAGAAAGGAGGG - Intronic
923305383 1:232683356-232683378 AGTGAGAAAGCCAGTGGGGAAGG + Intergenic
923766458 1:236896583-236896605 ACTGAGAGCTCCAGTGAAGAAGG - Intronic
924188622 1:241523696-241523718 AATGAGAAGTGAAGTGAAGATGG - Intergenic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1063430098 10:5980573-5980595 AGTGAGAAGTGCACAGAGGCGGG - Intergenic
1064488261 10:15820291-15820313 AGTGAGAGGACCAGTGTGGCTGG + Intronic
1066282346 10:33930178-33930200 GCTGAGAAGTCCAGTGTTGAGGG + Intergenic
1066542122 10:36458690-36458712 AGAGAGAAGTGCAGAGAGAAGGG + Intergenic
1067658602 10:48216857-48216879 ATTGGGAAGTCCTGGGAGGAGGG - Intronic
1068691151 10:59915948-59915970 AGTGAGAAATTTAGTGAGGCTGG + Intergenic
1068805339 10:61188775-61188797 AGTGAGAAATCCAGTCTGCAGGG - Intergenic
1070525965 10:77296253-77296275 AGTAAGAAGTGATGTGAGGAAGG + Intronic
1073190385 10:101646651-101646673 AGTGAGAAACCCAGGGAAGAAGG - Intronic
1074845512 10:117393962-117393984 TGAGAGAAGGCCAGTGAGGCTGG - Intergenic
1075703412 10:124483886-124483908 TGTATGAAGTCCAGTGAGGATGG + Intronic
1076090831 10:127684235-127684257 AGTGGGAAATGCAGTGAGGGAGG - Intergenic
1077853720 11:6100579-6100601 ACTGAGAAAGCCAGGGAGGAAGG - Intergenic
1080366947 11:31585803-31585825 AGTGAGAAGACCAGGCATGATGG + Intronic
1080556376 11:33421156-33421178 AGTGAGAAGAGCAGTGAAGCAGG - Intergenic
1080940723 11:36914608-36914630 AATAAGAAGTCCAGTTAGGTCGG - Intergenic
1081748867 11:45493492-45493514 AGCAAGAAGGCCAGTGAGGCTGG - Intergenic
1082211674 11:49510677-49510699 AATAAGAAGTCCAAAGAGGAGGG + Intergenic
1082996396 11:59259110-59259132 AGTGAAAGGGCCAATGAGGAGGG - Intergenic
1083189709 11:61041165-61041187 AGTGAAGAGTGCACTGAGGAAGG - Intergenic
1084160923 11:67349670-67349692 ACTGAGGAGGCCAGTGAGGCTGG - Intronic
1084303815 11:68268294-68268316 AAGGAAAATTCCAGTGAGGAGGG + Intronic
1084712257 11:70851116-70851138 AGTGGAAAGTCCAGAGAGTAGGG - Intronic
1085735867 11:79038504-79038526 AGAAAGAAGGCCAGTGAAGAGGG - Intronic
1086959686 11:92969595-92969617 AGGGAGGAGGCCAGTGGGGAGGG - Intergenic
1087460482 11:98439407-98439429 AGTGAGAAGGCTAGTGGGAAGGG - Intergenic
1087777453 11:102269247-102269269 AGTGGGAAGTGCTGTGAGGGTGG + Intergenic
1088193028 11:107247192-107247214 GTTGTGAAGTCCAGTGAGGTAGG + Intergenic
1088824549 11:113482801-113482823 TGTGGGAAATCCTGTGAGGATGG + Intergenic
1088889525 11:114033540-114033562 ACTCAGCAGACCAGTGAGGAAGG + Intergenic
1089056000 11:115585371-115585393 AGTGGGAAGGCCAGTGAAGAAGG + Intergenic
1092170686 12:6372248-6372270 ACTGACAAGTCCAGGGAGGTGGG - Intronic
1092192482 12:6531055-6531077 AGTGATGAGTCCAGTGAGGAAGG + Exonic
1093546878 12:20359204-20359226 ATGGAGCACTCCAGTGAGGAAGG + Intergenic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1095193230 12:39283141-39283163 AGTTGGAAGTCAAGTGAGAAAGG + Intergenic
1095935075 12:47670721-47670743 GGTGAGAAGTCCAGTGGGGCTGG + Intronic
1096025607 12:48358528-48358550 ACTGAGATGTCCAATGATGACGG - Intergenic
1096861282 12:54530311-54530333 AGTGACAAATCCAGATAGGAAGG - Intronic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097916532 12:65026357-65026379 AGTGGGGAGTCCAGTGTGGTTGG - Intergenic
1098044347 12:66384669-66384691 AGTAAGAAGATAAGTGAGGAAGG + Intronic
1098183643 12:67874491-67874513 AGAGACAATTCCAGTGAGCAAGG - Intergenic
1101276740 12:103210495-103210517 AATGAGAAGTCCCCTGATGATGG - Intergenic
1102819332 12:115894660-115894682 AGTGAGAAGGCCAGTGTGGTTGG + Intergenic
1103261404 12:119592403-119592425 AGTGTGCAGTCCAATGAGGGAGG + Intergenic
1103742308 12:123099130-123099152 AATCAGAGATCCAGTGAGGAAGG - Intronic
1104835033 12:131784184-131784206 ACTGAGCAGTCCAGGAAGGAGGG + Intronic
1106433706 13:29705960-29705982 AGTGAGAAATGCACTGAGAAGGG + Intergenic
1106564772 13:30874655-30874677 AGAGAAAATTCCTGTGAGGAAGG - Intergenic
1106774061 13:32991486-32991508 AGCGGGAAGACCAGTGAGGAGGG + Intergenic
1107143716 13:37034085-37034107 AGTAAGAAGTCCTGAGAAGAAGG - Intronic
1107200982 13:37716922-37716944 AGAGAGAAGTCTGGTGGGGACGG + Intronic
1107461205 13:40605523-40605545 ATTGAGAAGTACAGTGTGGTTGG - Intronic
1108342632 13:49513138-49513160 AGAAAGAAATCCAGAGAGGAAGG + Exonic
1108690444 13:52855047-52855069 TGTGAGAAGTGCTGTGAGGAAGG + Intergenic
1108712478 13:53047278-53047300 GGTGAGAAGCTCAGTGAAGATGG + Intronic
1109428124 13:62194503-62194525 AGTGAGAAGGACATAGAGGATGG - Intergenic
1112203653 13:97302827-97302849 AGTGAAAAGGACAGTGAAGAAGG + Intronic
1113961928 13:114131053-114131075 TTTGAGTAGTCCAGAGAGGAGGG - Intronic
1114572623 14:23684211-23684233 AGCGAGAAGGCCAGTGTGGCTGG + Intergenic
1114846889 14:26333204-26333226 AGTGAGAAGGCCAGGGTGGCTGG - Intergenic
1114942083 14:27624829-27624851 AGAGAGAAGTCCAGTGCAAAAGG + Intergenic
1116423716 14:44764362-44764384 AGTGAGAAGTTCAGACTGGAAGG + Intergenic
1117904533 14:60570374-60570396 AGTGAGATTTGCAGTGAGAAAGG + Intergenic
1118048995 14:62005436-62005458 ACTGAGAAGTACAGAGAAGAAGG - Intronic
1119204345 14:72783010-72783032 AGAAAGGAGTGCAGTGAGGATGG - Intronic
1119387331 14:74265858-74265880 AGAGAGAAGTCCTGTTAGGTGGG + Intergenic
1119412510 14:74442464-74442486 AGAAAGAAGGCCAGTGAGGTGGG + Intergenic
1120761387 14:88288726-88288748 AATGAGAAGACCAGTGTGGCTGG - Intronic
1121171789 14:91860658-91860680 AGTAAGAAGACCAGTGTGGTTGG - Intronic
1121854378 14:97253221-97253243 AGTGAGTATTCCAGTGAACAAGG + Intergenic
1121867501 14:97376714-97376736 ACTGAAAAGTCCAGTGAGGCTGG - Intergenic
1122366391 14:101197307-101197329 AGTGGGAGGGCCAGTGAGGATGG - Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1125368329 15:38942924-38942946 AGGGAGAAGAGCAGGGAGGAAGG + Intergenic
1126685115 15:51241608-51241630 GAGGAGAAATCCAGTGAGGAAGG + Intronic
1126738593 15:51755608-51755630 AGTGTGGAGTCCAGTGAGCTGGG + Intronic
1127473305 15:59309604-59309626 TGTGAGAAGTCCACTCAGTATGG + Intronic
1128062960 15:64746867-64746889 GGTGAGAAGCCCAGTGAGGTGGG + Intronic
1128748985 15:70135027-70135049 ACTGAGCAGTTCAGTGAGGCTGG - Intergenic
1129169598 15:73799530-73799552 AGTGGGAGATCCAGGGAGGAGGG + Intergenic
1129874199 15:78961878-78961900 AGTGAGGAGTCTAGGGAAGAGGG + Exonic
1129947198 15:79549500-79549522 AGTCAGAAGTCCAGGGAAGGAGG - Intergenic
1130931705 15:88433230-88433252 AGGGACAAGTCCAGTGTGGCTGG - Intergenic
1131095900 15:89654362-89654384 AGTGAGTAGTCCAGGGAGGCAGG - Intronic
1131551264 15:93359050-93359072 AGAGAGAATTCCAGTGGGGGAGG + Intergenic
1132275890 15:100563633-100563655 GGGGAGAAGGCCAGGGAGGATGG + Intronic
1133282236 16:4673361-4673383 AAAGAGAAGTCCAGAGGGGAGGG - Intronic
1133483346 16:6193770-6193792 AGTGACAAACCCAGTGGGGAGGG - Intronic
1133601209 16:7341998-7342020 GGGGAGAATTGCAGTGAGGAGGG + Intronic
1133923677 16:10177703-10177725 TTTGAGAAGTCCAGGGAGTATGG - Intronic
1134467573 16:14492874-14492896 AAAGAGAAGTCCAGGGAGGCAGG - Intronic
1134467782 16:14494676-14494698 ACTGAGGAGTTCAGTCAGGAGGG + Intronic
1134692972 16:16203262-16203284 GGTGAGAAGGACACTGAGGAAGG - Intronic
1134862497 16:17573117-17573139 AGTGTGAGGACCACTGAGGATGG + Intergenic
1135086406 16:19478113-19478135 AATGAGAAGGCCAGGGAGGCTGG - Intronic
1135877142 16:26213164-26213186 TGTGAGAAGTGCTGTGATGAGGG + Intergenic
1136418960 16:30120576-30120598 AGTGAGAAGTCCTAAGAAGAAGG + Intronic
1136690392 16:32024388-32024410 TGTGAGAGGGCCAGTGGGGACGG + Intergenic
1136790981 16:32967952-32967974 TGTGAGAGGGCCAGTGGGGACGG + Intergenic
1136878832 16:33885980-33886002 TGTGAGAGGGCCAGTGGGGACGG - Intergenic
1138313061 16:56044611-56044633 AGTGAGAATCCCAGCCAGGAGGG - Intergenic
1140985908 16:80157772-80157794 AGAGAGAAGCCACGTGAGGAGGG - Intergenic
1203093186 16_KI270728v1_random:1229409-1229431 TGTGAGAGGGCCAGTGGGGACGG + Intergenic
1142985785 17:3694846-3694868 TGTGGGAAGGCCAGGGAGGAAGG + Intronic
1143105942 17:4530620-4530642 AGCCAGAAGTACTGTGAGGAGGG - Exonic
1143457637 17:7078181-7078203 AGGGAGCTGTCTAGTGAGGAGGG + Intronic
1145940059 17:28738646-28738668 GGGGAGAAGGGCAGTGAGGAAGG - Intronic
1146486616 17:33248270-33248292 AGTGAGAAGGCCAGTGTAGGTGG + Intronic
1148478713 17:47946114-47946136 AGTGAAAAGGACAGTGAGAAGGG + Intronic
1149284876 17:55151229-55151251 AGTTAGAAGTAGAGTGGGGAGGG + Intronic
1151647180 17:75441259-75441281 AGAGAGAAGGCCAGTGTGGCTGG + Intronic
1151720267 17:75851186-75851208 AGTGAGAAATCCAGTAAACAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155117922 18:22787864-22787886 AGTGAGCAGGCCACTTAGGAAGG + Intergenic
1156253157 18:35371479-35371501 GTTGAGAAGTCCAGGGTGGAGGG + Intronic
1157092290 18:44650423-44650445 AGCGAGAAGGTCAGTGAGGGTGG + Intergenic
1157688997 18:49665465-49665487 TCTGAGAAGTCCAAGGAGGAGGG - Intergenic
1158448206 18:57539700-57539722 AGTGACAAGCCCGCTGAGGAGGG - Intergenic
1159034791 18:63266438-63266460 AGTGGGAGGTAAAGTGAGGAGGG + Intronic
1159064706 18:63557126-63557148 TGTGACAGGTACAGTGAGGAGGG - Intronic
1159498634 18:69239069-69239091 AGTAAGAAGTCTGGGGAGGAGGG + Intergenic
1161232933 19:3184144-3184166 AGGCAGAAGTCAAGTGACGAAGG - Intergenic
1161289394 19:3484982-3485004 AGTGAGGAGGCCAGTGTGGCTGG + Intergenic
1161738377 19:6005599-6005621 AGTGACAGGCACAGTGAGGAAGG - Intronic
1161769591 19:6223995-6224017 AGTGAGAGTACCAGGGAGGAGGG + Intronic
1162142049 19:8591037-8591059 AGTGAGAAGTTTACTGGGGAGGG - Intronic
1162757528 19:12869128-12869150 GGTGAGGAGTCCCGTGAGGATGG - Exonic
1165608972 19:37133986-37134008 AGGAAGAAGTCCAGTGAAGTGGG - Intronic
1166053294 19:40273942-40273964 AGCGAGCAGACCAGTGAGGCTGG - Intronic
1166299195 19:41904618-41904640 GGCCAGGAGTCCAGTGAGGAGGG + Intronic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
1167413714 19:49359999-49360021 AGTGAGGAAGGCAGTGAGGAGGG - Exonic
1167661666 19:50799144-50799166 AGTGAGATGTCCAGTGTCCAGGG - Intronic
1167670828 19:50852327-50852349 AGTATGAAGACCAGTTAGGATGG + Intergenic
1168367027 19:55797017-55797039 AGTGAGGAGATCAGGGAGGATGG - Intronic
1202705794 1_KI270713v1_random:22647-22669 AGTGATAAAACCAGTAAGGAAGG - Intergenic
925445971 2:3927275-3927297 CGTCAGCAGTCCTGTGAGGAGGG - Intergenic
925455380 2:4012085-4012107 AGTGAGAAGTCCACTGGAGGTGG + Intergenic
925531577 2:4868873-4868895 AGTGAGAACTACTGTGAGGTGGG + Intergenic
925878087 2:8328817-8328839 AGAGTGAAGTCCAGGGAGGGAGG + Intergenic
927403472 2:22741374-22741396 AGTGAGGAATGCAGTGAAGAGGG - Intergenic
928521176 2:32090346-32090368 AGTGGGATGTCAAGTGAAGATGG - Intronic
930775055 2:55162907-55162929 AGTGATAACACCAGTGATGATGG + Intergenic
931690649 2:64832099-64832121 AAAGAGAAGTCCAGTGTGAAAGG - Intergenic
932966364 2:76480136-76480158 AGTGAGCACTCCAGTGACAAAGG - Intergenic
932969458 2:76522319-76522341 AATGAGAAGTGCAGTGAACATGG + Intergenic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
936011569 2:108928424-108928446 AGTGATGAGGCCAGTGGGGACGG - Intronic
936404987 2:112194928-112194950 AGTGAGAAATCCAATGTGGGTGG + Intergenic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937443637 2:121937926-121937948 GGAGAGAGGTCCAGTGAGGTAGG + Intergenic
938967786 2:136403999-136404021 AGTGAAAAGTTCAGTTTGGATGG - Intergenic
939087201 2:137735707-137735729 AGTGAGAATTCTGGTGAGGCAGG + Intergenic
939460224 2:142489593-142489615 AGAGAGAAGGCCAGTGTTGAGGG + Intergenic
940903249 2:159146204-159146226 AGTGAGAAGTTCAGTGAGAGAGG + Intronic
941221086 2:162782500-162782522 AATGAGAAGGCCAGTGTGGCTGG + Intronic
941426793 2:165356796-165356818 AGAGGGAAGTCCAGTGATGTGGG + Intronic
942857572 2:180568425-180568447 ACTGAGACGCCCAGTGATGAAGG - Intergenic
944287975 2:197973682-197973704 AGGAAGAAGTCCAGTGTGGCCGG + Intronic
944308352 2:198203540-198203562 AGTTAAAAGTCCAGTGTGGGTGG + Intronic
944407030 2:199396587-199396609 AGAGAGGAGCCAAGTGAGGATGG + Intronic
944561722 2:200945973-200945995 AGTGAGGAGTTCAGTCAGGCTGG - Intronic
945159215 2:206871928-206871950 GCTGAGAAGTCCAGTGTTGAGGG - Intergenic
947642718 2:231715932-231715954 TGTGTGGAGTCCAGTGAGTAAGG - Intergenic
948529303 2:238593910-238593932 GATGAGACGTTCAGTGAGGAGGG + Intergenic
948536325 2:238650306-238650328 AGTGAGGATTCCTGTGGGGAGGG + Intergenic
948666995 2:239542342-239542364 ACTGGGAATTCCAGGGAGGAAGG - Intergenic
948675815 2:239595944-239595966 AGTGAGGAGTTCAGTGATGGAGG + Intergenic
948766074 2:240219780-240219802 AGCGAGGAGTTCAGGGAGGATGG - Intergenic
1170687675 20:18584277-18584299 GGTAGGAAGACCAGTGAGGAAGG + Intronic
1173609873 20:44359242-44359264 AGTGAGGAGGGCAGAGAGGAAGG - Intronic
1174306023 20:49614906-49614928 AGTGAGGAGGCCAGAGAGGCTGG + Intergenic
1175040322 20:56043569-56043591 ACTGAGAGGTCCAGTAAGGTAGG - Intergenic
1175187690 20:57190067-57190089 AGTGAAGAGGCCAGTGAGGCTGG + Intronic
1175366334 20:58458832-58458854 AGAGAGAAGGCCAGTGTGGCCGG + Intergenic
1175394932 20:58651315-58651337 AGTGAGAAGGCCGGGGAGGCAGG + Exonic
1175786708 20:61716475-61716497 ACTCAGACCTCCAGTGAGGATGG - Intronic
1176052610 20:63128430-63128452 AGTCACACGTGCAGTGAGGACGG - Intergenic
1177475805 21:21620469-21620491 ATTGAGAGTTCCAGAGAGGAGGG + Intergenic
1178496557 21:33090893-33090915 AGTGAGAAAGACAGAGAGGAAGG + Intergenic
1180835826 22:18928920-18928942 CGTGAGAGGCCCAGGGAGGATGG - Intronic
1181712097 22:24697153-24697175 CGTGAGAGGCCCAGGGAGGACGG - Intergenic
1183149494 22:36027060-36027082 AATCAGAAGTCCAGAGAAGATGG - Intronic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184719696 22:46303931-46303953 AGTGAGGAGGCCAGGGAGCAGGG + Intronic
1185056051 22:48578845-48578867 AGTGAGAGGTGCAGGGAGGGGGG + Intronic
1185062264 22:48613209-48613231 AGAGAGGACTCCAGGGAGGAAGG - Intronic
1185336400 22:50272477-50272499 AGTGACAGCTCCAGTGAGGAGGG - Intergenic
1203285917 22_KI270734v1_random:154219-154241 CGTGAGAGGCCCAGGGAGGATGG - Intergenic
950160827 3:10759644-10759666 AGTGGGAACTCCACTGAGGCAGG - Intergenic
950354535 3:12395193-12395215 AGTGAAAAATCCAGTGAGTTAGG - Intronic
950616519 3:14164368-14164390 AGGCAGCAGTGCAGTGAGGAGGG - Intronic
950653006 3:14419339-14419361 AGTGACGTGCCCAGTGAGGAGGG - Intronic
950699342 3:14729404-14729426 AGTAAGAAGGCTAGTGAGGCTGG + Intronic
950904870 3:16528955-16528977 AGTGAGAAATCCACTGAGCCTGG + Intergenic
951031574 3:17887853-17887875 AGTGAGAAGTCCATAGAATATGG + Intronic
952269682 3:31818729-31818751 AGTGGGAATTCCACTCAGGAGGG - Intronic
953452137 3:43014257-43014279 AGTGAGAAGTCACGGGAAGAAGG + Intronic
954748230 3:52799027-52799049 AGTGAAATCTCCATTGAGGAGGG - Exonic
956180525 3:66513882-66513904 AATAAGAAGTTTAGTGAGGAAGG - Intergenic
958116688 3:89229011-89229033 AGTGAAAAGGGAAGTGAGGAAGG - Intronic
960644995 3:119870174-119870196 AGGCAGACTTCCAGTGAGGATGG - Intronic
964310321 3:155385320-155385342 AGTGGGAAGTTCAGTGTTGATGG - Intronic
964413696 3:156425908-156425930 AGAGAGAAGTCAAGTGGAGAGGG + Intronic
964444988 3:156749268-156749290 AGTGAAAAGTACATTTAGGAAGG - Intergenic
965138789 3:164808680-164808702 ACTGAGAAGTCCAGGGCTGAGGG + Intergenic
965599640 3:170442200-170442222 AGTCAGAAGTCCAGGGAGCCTGG + Intronic
966715663 3:183010999-183011021 AGTGAGAAGTTGATTGTGGAGGG + Intergenic
967267291 3:187701943-187701965 GGTGAGAGGTTCAGTGGGGAGGG - Exonic
968445930 4:652036-652058 AGTGTGGAGGCCAGTGAGGAGGG + Intronic
969930921 4:10629742-10629764 AGTGTGAAGTTCAGGGGGGAAGG + Intronic
970113875 4:12670968-12670990 GGAGAAAAGTCCAGTCAGGAAGG + Intergenic
970698969 4:18711926-18711948 AGAGAGAAATCAAGAGAGGATGG - Intergenic
971258614 4:25035653-25035675 AGCTAGAAGGCCAGTCAGGATGG + Intergenic
974087381 4:57275987-57276009 AGTGAAAAGTTGAGTGAGGATGG - Intergenic
975988692 4:80233608-80233630 AGTAAGTAGTTCAGTGAGAAAGG - Intergenic
976110389 4:81667198-81667220 AATGAGAAGGCCAGAGAGGCTGG - Intronic
976248841 4:83030294-83030316 AGTGTGAAGTCAAGTTAAGAAGG + Intergenic
976586773 4:86806682-86806704 AGAAAGAAGTCAAGTGAGAAGGG + Intronic
977727111 4:100309114-100309136 AGTGGGTAGTCCATTCAGGAAGG - Intergenic
979645619 4:123064300-123064322 AGTGAGACGTTGAGGGAGGAAGG + Intronic
979782075 4:124664770-124664792 GGTGAGAATTCCAGTGAGGGTGG + Exonic
980034742 4:127870994-127871016 AGTCAGAAGGCCAGTGTGGCTGG + Intergenic
980147316 4:129004306-129004328 AGTAAGAAGTCCAGTGAGTTTGG - Intronic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
981547866 4:145913038-145913060 AGTGTTAAGTCCTGTGAGGCTGG + Intronic
981756508 4:148145979-148146001 AGTGAGAAGAAAAGGGAGGAGGG + Intronic
983091271 4:163505614-163505636 GGTGAGAAGTTCAGTAAGAATGG + Intronic
983764192 4:171455779-171455801 AGTGAGAAATCCAATTTGGATGG - Intergenic
984153183 4:176160247-176160269 AGAAAGAAGGCCAGGGAGGAGGG - Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
986351682 5:6885828-6885850 AGTGAGATGTCCTTTGGGGAAGG + Intergenic
986407426 5:7440001-7440023 GGTGAGAAGTACAGAGAAGAGGG + Intronic
987388374 5:17352014-17352036 GGCCAGAAGTCCAATGAGGATGG + Intergenic
988427244 5:31078062-31078084 AGTGACAAGACCACTTAGGATGG - Intergenic
990794387 5:59523876-59523898 AGAGAGAAGTGCAGAGTGGAGGG - Intronic
991442903 5:66669765-66669787 AGTGAGAAGTACAGTGAGGGTGG + Intronic
992268544 5:75042157-75042179 AGTGAGAAGGGCAGAGAAGACGG - Intergenic
997043518 5:130286021-130286043 AGAGAGAACTCCAGTGAGAATGG + Intergenic
997595246 5:135103074-135103096 AGCTGGAAGACCAGTGAGGAGGG + Intronic
998314002 5:141163065-141163087 AGAGAGAAATTCAGTAAGGATGG + Intergenic
998325271 5:141274656-141274678 ATTAAGAAATCCAGTGAGGCCGG + Intergenic
1000029595 5:157390471-157390493 AGTGAGAGGTCGGGGGAGGAGGG - Intronic
1000402876 5:160850610-160850632 ACTGATAAGTCCAGTGAAGGAGG - Intronic
1001031779 5:168268627-168268649 GGTGAGAAGTTCAGAGAGGCCGG + Intergenic
1001305092 5:170566658-170566680 AGAGAGTGGGCCAGTGAGGAAGG + Intronic
1001967569 5:175922254-175922276 AGTAAGTAGCCCTGTGAGGAAGG - Intronic
1002453536 5:179332734-179332756 AGGGAGGAGTGCAGAGAGGAAGG + Intronic
1003594735 6:7464165-7464187 ACTGAGAACTCCAGGGAGGATGG + Intergenic
1003594913 6:7465840-7465862 ACTGAGAACTCCAGGGAGGATGG + Intergenic
1004484900 6:16057279-16057301 AGTGAGGAGGCCACTGTGGAAGG - Intergenic
1004639030 6:17496105-17496127 AGTGAGACAACCAGAGAGGAAGG + Intronic
1006251467 6:32790624-32790646 AATAAGAAGGCCAGTGAGGCTGG + Intergenic
1006448281 6:34091882-34091904 ATCCAGAAGTCCCGTGAGGACGG - Exonic
1006931275 6:37690099-37690121 AGTGAGGAGTCCAATGTGGCTGG - Intronic
1007662840 6:43496966-43496988 ACTGAGCTATCCAGTGAGGAAGG + Intronic
1008678160 6:53843790-53843812 ACAGAGCAGTTCAGTGAGGAGGG - Intronic
1009198429 6:60715090-60715112 ACTAAGAAGTCTAGAGAGGAAGG - Intergenic
1011998051 6:93618391-93618413 AGTGAGAAGGCTAGTTAGTAAGG + Intergenic
1014599169 6:123387553-123387575 AGTGAGAACGACAGTGAGAAAGG + Intronic
1016335779 6:143003414-143003436 AGAGGCAAGTCCACTGAGGAGGG + Intergenic
1016940930 6:149482410-149482432 AGTGTGACTTCCAGTCAGGACGG - Intronic
1017756170 6:157531433-157531455 AGTGAGACCTGCAGAGAGGAAGG - Intronic
1017985477 6:159439721-159439743 AGTGAGATATCCAGTAAAGAAGG - Intergenic
1018101531 6:160445207-160445229 AGGGAGCAGGCCAGGGAGGAAGG + Intronic
1018447913 6:163874967-163874989 AGAGGGAAATCCAGTAAGGATGG - Intergenic
1019138697 6:169929418-169929440 GATGAGAGGTCCAGTGAGAATGG + Intergenic
1020400442 7:7770557-7770579 AGAGAAAAGACCAGTTAGGAGGG + Intronic
1021149274 7:17129344-17129366 AGAGACATGCCCAGTGAGGATGG + Intergenic
1021545179 7:21804971-21804993 AGACAGAAGGCCAGTGAAGATGG - Intronic
1022532450 7:31075558-31075580 AGTGAGAAGAGCATGGAGGAAGG - Intronic
1022685389 7:32591505-32591527 ACTGTGAAGGCCAGTGAGGAAGG - Intergenic
1023032522 7:36103103-36103125 AGTGAGAAGACAAGAGAAGAAGG + Intergenic
1023166460 7:37348128-37348150 AATGAGATGTTCATTGAGGAGGG - Intronic
1023172591 7:37404214-37404236 AGGGAGTGGACCAGTGAGGATGG - Intronic
1023641947 7:42268176-42268198 ATTCAGCAGTCCAGTGAGAATGG - Intergenic
1023682308 7:42699923-42699945 AGTGAGAAATGCAGAGACGATGG + Intergenic
1023926645 7:44674502-44674524 ATTGACAAGTCTAGTGAGAATGG + Exonic
1026565535 7:71487007-71487029 ACTGAAAAGTCAAGGGAGGAGGG - Intronic
1029581519 7:101439597-101439619 TGTGAGAAGACCAGTGTGGCTGG + Intronic
1031053855 7:116972795-116972817 AGTGAGAAGTTGAGGGAGAAAGG - Intronic
1031132025 7:117843770-117843792 AGTGGGAGGACCAGTTAGGAAGG + Intronic
1031466859 7:122123757-122123779 AGTGAGAAGTCTAGGGATGGTGG - Intronic
1032282504 7:130515786-130515808 AGTAAGCAGGCCAGTGAGGAAGG + Intronic
1033087093 7:138352772-138352794 AGTGAGTATTCTAGTGAGCAGGG - Intergenic
1033127417 7:138718129-138718151 AGGGAGACGTCCAGGAAGGAAGG + Intronic
1033127447 7:138718340-138718362 AGGGAGACGTCCAGGAAGGAAGG + Intronic
1033127459 7:138718390-138718412 AGGGAGACGTCCAGGAAGGAAGG + Intronic
1035379846 7:158430822-158430844 AGTGAAAACAGCAGTGAGGAAGG + Intronic
1035900882 8:3457217-3457239 GATGAGAGGTGCAGTGAGGAGGG - Intronic
1035916400 8:3629078-3629100 AGTGAGAAGTCGGGGGAAGAAGG + Intronic
1035961112 8:4139460-4139482 CGTGGACAGTCCAGTGAGGAAGG + Intronic
1037950460 8:23015931-23015953 AATGAGAAGCCCAGAGAGGCAGG - Intronic
1038069274 8:23995440-23995462 ATTGAGAAGTGCAGTGGGGAAGG + Intergenic
1038499442 8:28031205-28031227 AGTGAGGAGAGCAGTGAGGTTGG - Intronic
1039308285 8:36287719-36287741 TGTGAGAAGTCCAGTCTGCAAGG - Intergenic
1039416473 8:37398777-37398799 AGTGTGTGGTGCAGTGAGGATGG + Intergenic
1041149111 8:54913314-54913336 AGTGAGAAGTCCAGGGTGCAGGG - Intergenic
1042370078 8:67981485-67981507 AGATAGAAGTCCAGGGAGGTAGG + Intronic
1043768289 8:84164487-84164509 AGTGAGAAGTGTAGGGAGAAAGG - Intergenic
1044230625 8:89773430-89773452 AGTGAGAAGGCCTGTGTGGCTGG + Intronic
1044827037 8:96208572-96208594 AGCAAGAAGGCCAGTGAGTATGG - Intergenic
1046530517 8:115439095-115439117 AGTGAGAAGTGCAGTGGGGCTGG + Intronic
1046635354 8:116669425-116669447 ACTGAGAAGAGCAGTGGGGATGG + Intronic
1047007513 8:120636100-120636122 GCTGAGAAGTCCAGTGTTGAGGG + Intronic
1048005680 8:130417662-130417684 ACTGACAAGTCCAGGAAGGATGG + Intronic
1048415988 8:134228306-134228328 AGTGACAGGTCCAGTTTGGAAGG - Intergenic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1048627087 8:136197043-136197065 AGTGAGATTTCCAGTAATGAAGG + Intergenic
1049342454 8:142120493-142120515 AGGGAGAAGGCCTGTGAAGATGG - Intergenic
1049673871 8:143881142-143881164 AGTGAGACGCACAGCGAGGAGGG - Intergenic
1050036431 9:1440567-1440589 AGGGTGAAGTTCAGTGAGGATGG - Intergenic
1052020175 9:23516798-23516820 AGTTACATGTCCACTGAGGAGGG + Intergenic
1053161849 9:35818825-35818847 AGTCAGAAGGCCAGGCAGGAAGG - Intronic
1053289279 9:36869339-36869361 AGTGGGAGGTGGAGTGAGGAGGG - Intronic
1056914269 9:90730830-90730852 AGTGAGGAGTCCAGGCAGAAAGG - Intergenic
1058878255 9:109262890-109262912 GGCGTGCAGTCCAGTGAGGAAGG - Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059371516 9:113843346-113843368 AGTGAGAAGTACAGAGTGGCAGG + Intergenic
1060640279 9:125232412-125232434 ATTGGGTAGTCCAGGGAGGAAGG - Intronic
1061761397 9:132854410-132854432 GGTGAGCAGTCCACTGAGGCCGG - Intronic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1061971474 9:134047664-134047686 AGTGAGGCGGCCAGTGGGGATGG - Intronic
1062354817 9:136156948-136156970 AGGGAGGCGTCCAGTGGGGACGG - Intergenic
1062652532 9:137585598-137585620 CCTGAGAGGCCCAGTGAGGAAGG + Intronic
1203693546 Un_GL000214v1:69675-69697 AGTGAAAAGTCAAGTGTGTATGG - Intergenic
1203445057 Un_GL000219v1:46145-46167 TGGGTGAAGTCTAGTGAGGAGGG + Intergenic
1203557997 Un_KI270744v1:18042-18064 AGTGAAAAGTCAAGTGTGTATGG - Intergenic
1203642727 Un_KI270751v1:34388-34410 AGTGAAAAGTCAAGTGTGTATGG + Intergenic
1187106302 X:16245938-16245960 AGAGAGAAGGCCAGTGTGGCTGG + Intergenic
1188474591 X:30577856-30577878 AGTGGGAAGTCCCGGGAGGTGGG + Intergenic
1189863179 X:45294361-45294383 AGGAAGAAGGCCAGTGAGGCTGG - Intergenic
1190411763 X:50143579-50143601 AGTGAGGAGGCCAGTGTGGCTGG - Intergenic
1190449834 X:50567848-50567870 AGTGAAAAGTCCAGTGAAAAGGG + Intergenic
1190949604 X:55130306-55130328 AGTTAGAACCCCAGTGGGGAAGG - Intronic
1192472226 X:71409033-71409055 AGAGAGACGTTCAGTGTGGATGG + Intronic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1192543658 X:71995499-71995521 AGTGAGGAGGCCAGTGTGGCTGG - Intergenic
1193814186 X:86085478-86085500 TGTGAGAAGTCCATTGAAGTGGG - Intergenic
1194438323 X:93896980-93897002 AATGAGAGGTCCAGTGTGGTGGG + Intergenic
1196055915 X:111354854-111354876 AGTAAGAGGTACAGTGAGAAGGG - Intronic
1196130485 X:112150076-112150098 AGTGAGGAGGCCAGTGTGGTGGG + Intergenic
1197146691 X:123179828-123179850 AGTGTTTAGTCCAGAGAGGAAGG + Intergenic
1198393096 X:136196169-136196191 AGTGAGGAGGCCAGTGAGGTGGG + Intronic
1198656453 X:138918701-138918723 TGTGAGAAGTACAATAAGGAGGG + Intronic
1199187720 X:144936946-144936968 AGAGAGAAGTCCACTGAAAAGGG + Intergenic
1199247062 X:145617670-145617692 AGAGAGAAATCCAGTGTGGCTGG - Intergenic