ID: 902079165

View in Genome Browser
Species Human (GRCh38)
Location 1:13809361-13809383
Sequence CAGTGGTAGAAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 798
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 743}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902079158_902079165 -1 Left 902079158 1:13809339-13809361 CCAGGCGAGAGGTGGTCCCCGAC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 743
902079152_902079165 26 Left 902079152 1:13809312-13809334 CCAGTGAGGAAGGCGCCTTGCAG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 743
902079155_902079165 11 Left 902079155 1:13809327-13809349 CCTTGCAGGACTCCAGGCGAGAG 0: 1
1: 1
2: 1
3: 16
4: 179
Right 902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 743

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902079165 Original CRISPR CAGTGGTAGAAGAGGAAGGA AGG Intronic
900558378 1:3291342-3291364 CAGGGGCAGAAGGGGAAGAAGGG - Intronic
900882915 1:5394724-5394746 GAGAGGAAGAAAAGGAAGGAAGG + Intergenic
900916559 1:5643740-5643762 CAGAGCTGGAAGAGGAAGGGCGG + Intergenic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
901646513 1:10719714-10719736 CAGTGAGAGAAGAGGCAGCAGGG + Intronic
901872638 1:12147036-12147058 CAGTGGTGGAAGAGGCACGGTGG + Intergenic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902449011 1:16484971-16484993 CAGTGGTGGACCAGGAAGGGAGG - Intergenic
902783932 1:18721100-18721122 GAGTGGGAGAAGAGGCTGGAGGG - Intronic
902919929 1:19659620-19659642 AAGGGGAAGAAGAGAAAGGAAGG + Intergenic
903773776 1:25780331-25780353 CAGAGGGAGCTGAGGAAGGAGGG - Intronic
903777633 1:25803020-25803042 CACTGCTAGAGGAGGAAGGTTGG + Intronic
903890685 1:26568365-26568387 CAGTGGCAGAATAGTAGGGATGG - Intronic
904396980 1:30228538-30228560 AAGTGGCAGAACAGGAAGCAGGG - Intergenic
904412046 1:30330437-30330459 GAGAGGAAGGAGAGGAAGGAGGG - Intergenic
905649625 1:39647564-39647586 CAGTGGCAGAATAGGGAGGTCGG - Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
905871442 1:41406686-41406708 CAGGGGGAGAAGAGGAAAAAGGG - Intergenic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907222548 1:52917557-52917579 CATGGGTAGAGGAGGGAGGATGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908029328 1:59983124-59983146 CAGTGGCAGATGAGGCAGGAGGG + Intergenic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908376607 1:63548585-63548607 AAGTGGAAGAAGAAGAAAGAGGG - Intronic
908792985 1:67801902-67801924 AAGTGGAAGAAAAGGGAGGAAGG + Intronic
909023790 1:70460937-70460959 GATTAGTAAAAGAGGAAGGAAGG - Intergenic
910521296 1:88124844-88124866 GAGTGAAGGAAGAGGAAGGAAGG + Intergenic
910554604 1:88517477-88517499 GAGGAGGAGAAGAGGAAGGAAGG + Intergenic
911721081 1:101191883-101191905 CAGAGGGAGAAGAGGAAGAGAGG + Intergenic
911885115 1:103288285-103288307 CAGTGTTGAAAGATGAAGGAAGG + Intergenic
912596083 1:110877821-110877843 CAGTTGTAGAGGAAGAAGTAGGG - Intronic
912620267 1:111149195-111149217 CAATAGTAGAAGAGGAATTAAGG - Intronic
912776222 1:112508068-112508090 CAGGGCGAGAAGACGAAGGAGGG + Intronic
913057776 1:115178214-115178236 CAGAAGGAGAAAAGGAAGGAAGG - Intergenic
913333654 1:117687578-117687600 TACTGGTAGAGGAGGAAGGGTGG - Intergenic
913417594 1:118628938-118628960 CAGTGATACAAGAGGCAGTAGGG - Intergenic
913531521 1:119737302-119737324 CAGAGGGAGGAGAGGAAGGAAGG + Intronic
913601450 1:120425191-120425213 GATTAGTAAAAGAGGAAGGAAGG + Intergenic
913647899 1:120878266-120878288 GAAAGGAAGAAGAGGAAGGAAGG + Intergenic
914078729 1:144384580-144384602 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
914085597 1:144451404-144451426 GATTAGTAAAAGAGGAAGGAAGG - Intronic
914100450 1:144581922-144581944 GAAAGGAAGAAGAGGAAGGAAGG + Intergenic
914173636 1:145253124-145253146 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
914191489 1:145415383-145415405 GATTAGTAAAAGAGGAAGGAAGG - Intergenic
914260699 1:145996809-145996831 GAGAGGAAGGAGAGGAAGGAGGG + Intergenic
914298543 1:146355753-146355775 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
914362637 1:146948751-146948773 GATTAGTAAAAGAGGAAGGAAGG + Intronic
914444037 1:147734347-147734369 GATTAGTATAAGAGGAAGGAAGG - Intergenic
914489031 1:148138343-148138365 GATTAGTAAAAGAGGAAGGAAGG - Intronic
914528298 1:148494305-148494327 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
914589417 1:149093387-149093409 GATTAGTAAAAGAGGAAGGAAGG - Intronic
914638095 1:149572800-149572822 GAAAGGAAGAAGAGGAAGGAAGG + Intergenic
914728948 1:150353454-150353476 AAGTGGTAAGGGAGGAAGGAGGG + Intergenic
914765614 1:150635352-150635374 GATTAGTAAAAGAGGAAGGAAGG + Intergenic
914860816 1:151384421-151384443 GAGAGGTAGAAGTGGAAGTAGGG + Intergenic
914930167 1:151923963-151923985 TAGTTGTAGACGAGGAAGCATGG + Intergenic
915774007 1:158462421-158462443 GAGAAGTAGAGGAGGAAGGAAGG - Intergenic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916059028 1:161086422-161086444 CAGGAGTAGAAAAGTAAGGATGG + Intronic
916288976 1:163142779-163142801 CAAAGGGAGAAGAGGAAGGGAGG + Intronic
916386415 1:164276664-164276686 GAGAGAAAGAAGAGGAAGGAGGG + Intergenic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916462760 1:165044374-165044396 CTGTGGTAGGAGAGGAAAGTAGG - Intergenic
916616377 1:166445531-166445553 CACTAGAAGAAGAAGAAGGAAGG + Intergenic
917127097 1:171696653-171696675 CAGTGGTTGAGGAGGAGGAAGGG + Intergenic
917966790 1:180183831-180183853 CAATGTCAGAAGAGGAAGAAGGG - Intronic
918267739 1:182861518-182861540 TAGTGGTAGAAGGGAGAGGAAGG - Intronic
918383797 1:183984760-183984782 CAGCTGGAGAAGAGGAAGAAGGG - Intronic
919741608 1:200984481-200984503 GAGTGGTTGAAGCTGAAGGAAGG + Intronic
920185716 1:204158070-204158092 CAGAAGCAGAAGAGGAAGGGTGG - Intronic
920247586 1:204600034-204600056 CGGTGGGCGCAGAGGAAGGATGG + Intergenic
920893970 1:210024855-210024877 AAGTTTTAGAAGAAGAAGGAAGG + Intronic
920976448 1:210790357-210790379 CAGTGGTAGAAGATCAAGTCAGG - Intronic
921650394 1:217671586-217671608 CAGAAGGAGAAGAGAAAGGAAGG - Intronic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922244832 1:223785982-223786004 CAGTGGAAGGAAAGGAAGGAGGG + Intronic
922323779 1:224510219-224510241 CAGAGGTAGAAGAAGCTGGAGGG + Intronic
923006375 1:230053391-230053413 CAGTGGTGGATGGGGAAGGGAGG - Intergenic
923051745 1:230394980-230395002 GAGTGGGAGGAGAGGAAGGGAGG - Intronic
923274030 1:232381108-232381130 CAGTGGAAGACGAGGGAGTAGGG + Intergenic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
924286163 1:242489443-242489465 CAGAGGAAGGACAGGAAGGAGGG + Intronic
924809705 1:247390215-247390237 CAGGTTAAGAAGAGGAAGGAGGG - Intergenic
1062888767 10:1039296-1039318 AAATGGTATAATAGGAAGGAAGG - Intergenic
1063177825 10:3568137-3568159 CTTTGGTAGAAGAGGAGGCATGG + Intergenic
1063432862 10:6006195-6006217 CAGTGAGAGGAGATGAAGGAGGG + Intergenic
1063507054 10:6609137-6609159 CTGAGGTAGCAGAGAAAGGAGGG + Intergenic
1065239561 10:23692590-23692612 CAGTGGGAAATAAGGAAGGAGGG + Intergenic
1065314255 10:24446936-24446958 CAGTGGTGGGAAAGGACGGACGG - Intronic
1065366677 10:24944067-24944089 CAGAGGTAGAGGAGGAAAGGGGG - Intronic
1066340949 10:34533266-34533288 CACTACTAGAAGAGGGAGGAAGG + Intronic
1066619021 10:37324651-37324673 CAGTGGTCGAATAGGACTGATGG + Intronic
1067515907 10:46943366-46943388 CAGTATTAGACAAGGAAGGAAGG + Intronic
1067646343 10:48108444-48108466 CAGTATTAGACAAGGAAGGAAGG - Intergenic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068092487 10:52449936-52449958 TAATAGTGGAAGAGGAAGGAAGG - Intergenic
1068905331 10:62315785-62315807 CAGCGATAGAGGAGGGAGGAGGG + Intergenic
1068914766 10:62417953-62417975 GAGTGAGAGAACAGGAAGGAGGG + Intronic
1069373287 10:67769072-67769094 CAGTGCTAGAAGACAAAGAATGG - Intergenic
1070327724 10:75399380-75399402 CAGTGGTAGCTGAGGCAGTAAGG + Exonic
1070363740 10:75716008-75716030 CAGTGCTAGAAGAGGCATGCTGG + Intronic
1070601052 10:77866503-77866525 GAGTGGCAGAAGAAGAAGGCGGG - Intronic
1070734725 10:78855616-78855638 CAGTGGGAGATGAGGCAGGCAGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071137328 10:82467476-82467498 CAGTCCTGGAAAAGGAAGGAAGG + Intronic
1072306682 10:94114342-94114364 CAGGGGCAGAGGAGGAGGGAGGG + Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072898580 10:99388056-99388078 AAGGGCTAGAAGAGGAAGGCAGG - Intronic
1073048672 10:100654424-100654446 GAGAGGGAGAGGAGGAAGGAGGG - Intergenic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073347723 10:102796924-102796946 CACTGGTGGATGAGGATGGAGGG - Intronic
1075136707 10:119793079-119793101 CAGTGGTAGAGGAGAAAAGCAGG + Intronic
1075682815 10:124344390-124344412 CAGGGGTAGAAGTGGAAGCAGGG - Intergenic
1075879450 10:125837848-125837870 CTGTCGGGGAAGAGGAAGGAGGG - Intronic
1077433217 11:2526267-2526289 CAGGGGGAGATGAGGATGGATGG + Intronic
1077788206 11:5408395-5408417 CAAAGGAAGAAAAGGAAGGAAGG - Intronic
1078604171 11:12760469-12760491 AAGAGGTAGGAGAGGAAGGGAGG - Intronic
1079009777 11:16818381-16818403 CAGTGTTATAAGAGTAAGAAGGG - Intronic
1079194396 11:18312818-18312840 CAATGGTAGAACAGGAAAAATGG + Intronic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1079751108 11:24198637-24198659 GAGTGGTTGCAGAGGAAGGCTGG - Intergenic
1080050809 11:27857136-27857158 CAGAGCTGGAAAAGGAAGGAAGG - Intergenic
1080614175 11:33931750-33931772 CAGAGGGTGAACAGGAAGGAAGG - Intergenic
1080891497 11:36412479-36412501 GAGTGGGAAAAGCGGAAGGAAGG + Intronic
1081017372 11:37899767-37899789 GAGTGGTAAAGGAGGAGGGAGGG - Intergenic
1081197684 11:40181219-40181241 GAGAGGAAGAAGAGAAAGGAGGG - Intronic
1081566366 11:44263543-44263565 CTGTGGAAGAAGTGTAAGGACGG + Exonic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1082812211 11:57485175-57485197 CGGTAATAGAAGAGGTAGGAAGG + Exonic
1082959145 11:58902333-58902355 CAATGGCAGAAGTGGCAGGAAGG - Intronic
1082965795 11:58965004-58965026 CAATGGAAGAAGTGGCAGGAAGG - Intronic
1083178912 11:60971923-60971945 CAGTGGCAGGAGATGAGGGAAGG - Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1085084842 11:73660334-73660356 CAGGGGTTGGGGAGGAAGGAAGG - Intronic
1085342358 11:75741375-75741397 GACTGGTAGAAGGGGAAGGCAGG + Intergenic
1087117079 11:94537019-94537041 CAGTGGTGGAAGATGAAGAGTGG + Intergenic
1087787193 11:102368678-102368700 AAGGGGTAGAAAAGGAGGGATGG - Intronic
1088396672 11:109377102-109377124 CAGCTGTAAAAGAGAAAGGATGG - Intergenic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1088714557 11:112537437-112537459 CACAGGTAGATGGGGAAGGAAGG + Intergenic
1088934647 11:114387444-114387466 CCATGGCAGAAGAGCAAGGAAGG - Intergenic
1088971798 11:114780443-114780465 ATGTGGTAGAAGAGTTAGGAAGG + Intergenic
1089125350 11:116172726-116172748 AAGTGTTAGAAATGGAAGGAGGG + Intergenic
1089688410 11:120171146-120171168 CAGTGATAGAACATGAAGGACGG - Exonic
1090188353 11:124752370-124752392 CTTGGGGAGAAGAGGAAGGAAGG - Intergenic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1090886052 11:130877872-130877894 CAGTTCCAGAAGAAGAAGGAGGG - Exonic
1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG + Intronic
1091364012 11:135001805-135001827 CAGTGGCCTCAGAGGAAGGAGGG + Intergenic
1091379416 12:46318-46340 CAGTGCCAGAAGAGGAAGTCAGG - Intergenic
1091665595 12:2416356-2416378 TGGTGGAAGAAAAGGAAGGAGGG + Intronic
1091691817 12:2602243-2602265 CCGTGGTGGAGGAGGCAGGAAGG - Intronic
1092078555 12:5693678-5693700 CAGTGGCTGGAGAAGAAGGAAGG - Intronic
1092924134 12:13258435-13258457 ATGTGCTACAAGAGGAAGGAGGG - Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1093409525 12:18847655-18847677 CAGTGGGAGAAGAGATAGAAAGG + Intergenic
1094250092 12:28349826-28349848 CAGTTGTAACAGAGGAATGAGGG - Intronic
1094715709 12:33013094-33013116 CACTGGTAAAAGAAGAAAGAGGG - Intergenic
1095251847 12:39988641-39988663 GAGAGGGAGAAAAGGAAGGAGGG + Intronic
1095508911 12:42928081-42928103 AGGTGGGAGAAGAGAAAGGAGGG - Intergenic
1095599956 12:44002738-44002760 CACTGGTAGAGAAGGAAGAAGGG - Intronic
1095724245 12:45434567-45434589 CTGGGATAGAAGAGGAAGGAGGG + Intronic
1095959248 12:47823677-47823699 GAGTGGAAGAAAAAGAAGGAAGG + Intronic
1096137529 12:49214929-49214951 AAGTGTTAGCTGAGGAAGGAAGG - Intronic
1096402635 12:51319965-51319987 GAGAGGGAGAAAAGGAAGGAAGG - Intronic
1096734117 12:53639534-53639556 GAGGGAAAGAAGAGGAAGGAAGG - Intronic
1096766684 12:53896749-53896771 CAGTGGTGGGTGTGGAAGGAAGG + Intergenic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1097772324 12:63602401-63602423 AAGTGGTAGAAATGGAAGAAAGG + Intronic
1097860664 12:64515429-64515451 CATTGGAACAAGAGAAAGGAGGG - Intergenic
1098066269 12:66620709-66620731 GAGAGGGAGAAAAGGAAGGAAGG - Intronic
1098401283 12:70079162-70079184 CAATGGAAGAGGAGAAAGGAGGG - Intergenic
1098654354 12:73009234-73009256 GATTAGTAAAAGAGGAAGGAAGG - Intergenic
1098838501 12:75449964-75449986 CAGAGGTTGAAGAGGAATGGAGG - Intergenic
1099423916 12:82499751-82499773 CAGCGGTAGCAGAAGAAGGTGGG + Intergenic
1099654310 12:85469444-85469466 GATTAGTAAAAGAGGAAGGAAGG - Intergenic
1100326367 12:93543492-93543514 CAGAGGTGGAAGAGCAAGGCTGG - Intergenic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1101010861 12:100447611-100447633 CAGGGCTAGAAGAGGAAGAAAGG - Intergenic
1101064734 12:101008175-101008197 AGGTGGTAGGAAAGGAAGGAAGG - Intronic
1101106756 12:101448133-101448155 GAGTTGTAGAAGAGGGATGATGG - Intergenic
1101952423 12:109187085-109187107 AAGGGGTAGGAAAGGAAGGAGGG + Intronic
1102086936 12:110149681-110149703 CAGTGGGAGAAGAGTCAGGGTGG - Intronic
1102143780 12:110638570-110638592 ATGTGGTAGAAGAGGAATCAAGG + Intronic
1102625150 12:114228809-114228831 TGGGGATAGAAGAGGAAGGAAGG + Intergenic
1102827893 12:115965709-115965731 CAGGGGAAGAAGAGGATGGCTGG + Intronic
1103117167 12:118345433-118345455 CAGGAATAGAAGAGGAAGGAAGG + Intronic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1104266655 12:127239772-127239794 CTCTGGAAGAAGAGAAAGGAGGG + Intergenic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1105050679 12:133047768-133047790 CAGTTGTATAAATGGAAGGATGG + Intronic
1105272516 13:18891703-18891725 CAGTTCCAGAAGAAGAAGGAGGG - Intergenic
1105353828 13:19639691-19639713 CAGGGGTAAGAGAGGAGGGAAGG + Intronic
1105453198 13:20518469-20518491 CGGTGGGGGGAGAGGAAGGAGGG + Intronic
1105688714 13:22814159-22814181 GATTAATAGAAGAGGAAGGAAGG - Intergenic
1105705008 13:22963201-22963223 GAGGAGTAGAAGGGGAAGGAGGG + Intergenic
1105857965 13:24388379-24388401 GAGGAGTAGAAGGGGAAGGAGGG + Intergenic
1105968401 13:25405197-25405219 CAGAAGGAGAAGAGGAGGGAAGG + Intronic
1106152678 13:27121362-27121384 GAGTGGAAGAGGTGGAAGGAGGG - Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1106708762 13:32309618-32309640 CAGAGATAGCACAGGAAGGAGGG - Intronic
1108157222 13:47597893-47597915 CATTTGTTGAAGAGGAGGGATGG + Intergenic
1108166398 13:47697780-47697802 AAGTGAAGGAAGAGGAAGGAAGG - Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111740418 13:92197878-92197900 GAGTGGTAGAGGTGGAAGTAGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111929685 13:94500921-94500943 CAGTGGTAGAAAAGTCTGGAAGG - Intergenic
1112643170 13:101300299-101300321 AAGAGGAAGAAGAAGAAGGAGGG - Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113754778 13:112803810-112803832 GAGGGGAAGGAGAGGAAGGAGGG - Intronic
1114346708 14:21804090-21804112 TGGTGAAAGAAGAGGAAGGATGG - Intergenic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1115629803 14:35232971-35232993 CTGTTGTAAAAGAGGAAGGAGGG - Intronic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1116052106 14:39816743-39816765 CAGAGGTTGAAGTGGGAGGAAGG - Intergenic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1117639460 14:57782973-57782995 CAATTGTAAAAAAGGAAGGAAGG + Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1119376828 14:74201390-74201412 CAGTGGTAGGATAGAATGGAAGG - Intergenic
1119461627 14:74809558-74809580 CAGCTGTAGAACAGGAACGATGG + Exonic
1119977845 14:79045231-79045253 CAGTAGGAGATGAAGAAGGAGGG - Intronic
1120913451 14:89688970-89688992 CAGAGATAGCAGAGGAAGCAAGG - Intergenic
1121428168 14:93868110-93868132 CAGTGGTAGAAGGGGAGTCAAGG + Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122442090 14:101738946-101738968 GAGAGGGAGAAAAGGAAGGAAGG + Intergenic
1123413541 15:20078965-20078987 TTGTAGTATAAGAGGAAGGAAGG + Intergenic
1123510417 15:20993024-20993046 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123522883 15:21086077-21086099 TTGTAGTATAAGAGGAAGGAAGG + Intergenic
1123567632 15:21566773-21566795 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123603891 15:22004066-22004088 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123978117 15:25571927-25571949 GACTGGTATTAGAGGAAGGATGG - Intergenic
1125890166 15:43260005-43260027 CACTGACAGAAGAGAAAGGAGGG + Intronic
1126790033 15:52212518-52212540 CACTCGCAGAAGAGGAAGGAAGG + Intronic
1126790209 15:52214109-52214131 CAGTGACAGAAGCAGAAGGAGGG + Intronic
1127065556 15:55234153-55234175 CAGTTGCAGATGAGGAAAGATGG - Intronic
1127119227 15:55757035-55757057 CAGAGGAAGAACAGGGAGGAAGG + Intergenic
1127705372 15:61541678-61541700 AAGTGGCAGAGTAGGAAGGAAGG + Intergenic
1127776918 15:62270812-62270834 CATTGGTCGACGAGAAAGGAGGG + Intergenic
1127922236 15:63503373-63503395 CAGAGCGAGAGGAGGAAGGAAGG - Intergenic
1128263332 15:66248129-66248151 CAGAGGCAGAAAAGGCAGGAGGG - Intronic
1128320999 15:66694208-66694230 CAGCTGTTGAAGATGAAGGAGGG - Intergenic
1128727980 15:70001820-70001842 AAGAGGAAGAAGAGGAAAGAAGG + Intergenic
1128881855 15:71251221-71251243 CAGCTGTAGATGAGAAAGGAAGG + Intronic
1129563970 15:76601796-76601818 CAGTGATAGAAGGGATAGGAAGG - Intronic
1129706059 15:77795243-77795265 AAGTGGGAGATGGGGAAGGAGGG - Intronic
1130443573 15:83978383-83978405 CAGTGGGAGAGGTGGAGGGATGG + Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1132073616 15:98801052-98801074 AAATGGTAGGAGAGGTAGGAAGG + Intronic
1202975995 15_KI270727v1_random:293868-293890 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1132860767 16:2070694-2070716 CAGTGGGTGCAGAGGAGGGACGG - Intronic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133431674 16:5742353-5742375 GAGAGGAAGGAGAGGAAGGAAGG - Intergenic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1134628328 16:15738917-15738939 CAGTGGCAGGAATGGAAGGAGGG - Intronic
1135316560 16:21451256-21451278 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135369482 16:21883501-21883523 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135442331 16:22487626-22487648 TAGTGAGTGAAGAGGAAGGAAGG + Intronic
1136071170 16:27788182-27788204 GAGTGGGAGAAGAGGAAAGTTGG - Exonic
1136237121 16:28921399-28921421 CAGTGGTAGACAGTGAAGGAGGG + Intronic
1136326673 16:29531735-29531757 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136441363 16:30271719-30271741 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1137189651 16:37852055-37852077 CAATGGTAGAAAAGGAAATATGG + Intergenic
1137210602 16:38197845-38197867 CAATGGTAGAAAAGGAAATATGG + Intergenic
1137521745 16:49200890-49200912 TGGTGGGAGAAGAGGAGGGAGGG - Intergenic
1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG + Intronic
1138676338 16:58654212-58654234 AAGAGGAAGAAGAGGAAGGTAGG - Intergenic
1138894829 16:61190829-61190851 AAGAGGAAGAAGAGGAAGAAGGG - Intergenic
1139365464 16:66429677-66429699 CAGAGGAAGAAGAGGAGAGAGGG - Intronic
1139608808 16:68039978-68040000 TTGTAGTATAAGAGGAAGGAAGG + Intronic
1139887858 16:70224032-70224054 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1140058469 16:71546410-71546432 ATGTGATAGAAGAGGAAAGACGG - Intronic
1140433133 16:74921946-74921968 CAGTGGAGGAAGCAGAAGGAAGG - Exonic
1140996441 16:80264291-80264313 CAGAGTTAGAAGAGGAGGAAAGG - Intergenic
1141206358 16:81935847-81935869 CAGTTATAGAAGAGGGAGAATGG - Intronic
1141337063 16:83165926-83165948 CAGTGGTGGGAGAGGCTGGAGGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141675632 16:85515841-85515863 CCTTGGCAGAAGAGGCAGGAGGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1143158657 17:4854675-4854697 CAGTTCTAGAAGTAGAAGGAAGG - Intronic
1143180794 17:4982806-4982828 CTCTGGAAGAAGCGGAAGGATGG - Exonic
1143530085 17:7497689-7497711 CAGCGGTTGAAGGGCAAGGAAGG + Exonic
1143855416 17:9844450-9844472 CAGGGGTGGAAGAAGAGGGAGGG + Intronic
1144042252 17:11422392-11422414 CAGTGGAATACCAGGAAGGAGGG + Intronic
1144180981 17:12752587-12752609 CACTGGTAGAAGAGGAAGACTGG - Exonic
1144185322 17:12790461-12790483 GAGGGGTGGGAGAGGAAGGAAGG + Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1146453270 17:32991234-32991256 CAGTGGTGGATGTGCAAGGATGG - Intronic
1146479586 17:33194082-33194104 CAGTGGCAGATGAGCATGGATGG - Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146657425 17:34643044-34643066 AAGTGGGAGAAGAAGAGGGAAGG + Intergenic
1146953293 17:36921243-36921265 CAGTGGGAGATGGGGAAGGCTGG - Intergenic
1147596765 17:41722889-41722911 CACTGGCAGAAGAGGGAGGGAGG + Exonic
1147938979 17:44032061-44032083 CAGTGGTAGAAGTGGGAGTGTGG - Intergenic
1150357567 17:64500297-64500319 CAGGGGTAGAGGAGGCATGAAGG - Exonic
1150552570 17:66224357-66224379 GAGAGGTAGAGGTGGAAGGAAGG + Intronic
1150888425 17:69114753-69114775 AAGTGGAACAAGAGGTAGGAGGG - Exonic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151553773 17:74836508-74836530 CAGTGGTACACCAGGAAGGCGGG - Exonic
1151828219 17:76535417-76535439 CAGTGGGGGAAGGGGAAGAAAGG - Intronic
1152010361 17:77709363-77709385 CTGTGGGAGATGAGGAGGGAGGG + Intergenic
1152641801 17:81452396-81452418 CAGTGGCAGAAGGGGGAGTAGGG + Intronic
1152718902 17:81912964-81912986 CAGCGGTACAAGTGGAAGGTGGG - Intronic
1152828436 17:82482170-82482192 CAGTGGTAGATGAGGCAGAGAGG + Intronic
1153957837 18:10113291-10113313 CAGTGAGAGAAGGGAAAGGAGGG - Intergenic
1154464295 18:14629285-14629307 CAGTTCCAGAAGAAGAAGGAGGG - Intergenic
1155066715 18:22274512-22274534 TTGTGGCAGAAGAGGAAGGTGGG - Intergenic
1156482409 18:37444664-37444686 CAGTTTCAGAGGAGGAAGGAGGG + Intronic
1156684518 18:39628372-39628394 CAGTGGCAGAAGGTGAAGGAGGG - Intergenic
1156782181 18:40863741-40863763 AAGTGTTTGAAGAAGAAGGAAGG - Intergenic
1156899600 18:42285747-42285769 GAGTGGTAGAGCAGGAAGGATGG + Intergenic
1157192982 18:45596905-45596927 CAATGGTAGAGGAGGTAGGTGGG - Intronic
1158197057 18:54899642-54899664 AAGAGGAAGAAGAAGAAGGAAGG - Intergenic
1158293522 18:55968882-55968904 CAGTGGTAATAAAGGAAGCAAGG - Intergenic
1158722474 18:59937908-59937930 CTTTGGTAGAACAGGAAGCAAGG + Intergenic
1159926058 18:74269944-74269966 CAGAGGTAGAAGATAAAGTAGGG + Intronic
1160313364 18:77818678-77818700 AAGAGGAAAAAGAGGAAGGAGGG - Intergenic
1161238213 19:3208312-3208334 CAGTCGGAGAAGGGGAAGGCTGG - Exonic
1162146923 19:8618105-8618127 CAGTATTAAAAGATGAAGGAGGG - Intergenic
1162178526 19:8849705-8849727 CAGATGTAGAGGAGGAAGGGAGG - Intronic
1162316938 19:9945158-9945180 CAGCAGAAAAAGAGGAAGGAAGG + Intergenic
1162519143 19:11168960-11168982 CAGAGGCAGAAGAGGAAGCATGG + Intronic
1162722932 19:12673143-12673165 CAGGGGTGGGAGAGGAGGGAAGG - Intronic
1162954995 19:14092507-14092529 GGGTGGGAGTAGAGGAAGGAGGG + Exonic
1163163901 19:15482277-15482299 CAGAGGTGGAAGAGGAGGAAGGG - Intronic
1163274470 19:16274612-16274634 AAGAGGAAGAAGAGGAAGCATGG + Intergenic
1163890384 19:20007495-20007517 CTGTGGTTGAAGAGGAAGATGGG + Intronic
1164570311 19:29369896-29369918 CAGAGGTAGGAAAGGAAGGCAGG + Intergenic
1164972184 19:32542014-32542036 CAGTGGGAGGAGGGTAAGGATGG + Intergenic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165476554 19:36034022-36034044 TGGTGGCAGAAGAAGAAGGATGG - Intergenic
1165680075 19:37766655-37766677 CAGAGGCAGAAGGGCAAGGATGG - Intronic
1166217001 19:41342298-41342320 CCCTGGAGGAAGAGGAAGGAAGG + Intronic
1166318434 19:42002015-42002037 AAGTGGGAGAAGGGGAAGAAGGG + Intronic
1166347631 19:42176456-42176478 CCGAGGCAGAAGAGAAAGGAGGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166738359 19:45099355-45099377 CACTAGTAGAAGAGGCAGCAGGG + Intronic
1167429113 19:49444080-49444102 AAGAGAAAGAAGAGGAAGGAAGG - Intergenic
1167613418 19:50518095-50518117 CCGTGGTAGAAGACGAGGCAGGG + Exonic
1167818619 19:51906132-51906154 GATTAGTATAAGAGGAAGGAAGG + Intronic
925069867 2:957777-957799 CAGAGCTAGAGGAGGCAGGAAGG + Intronic
925436964 2:3846820-3846842 AAGGGGGAGAAGATGAAGGAAGG + Intronic
926300698 2:11599989-11600011 CTGATGTAGATGAGGAAGGAGGG + Intronic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
927276285 2:21265115-21265137 CAGTGGATGGAGATGAAGGAAGG - Intergenic
927382384 2:22493729-22493751 ATGTGGTAGAAGGCGAAGGATGG - Intergenic
927510907 2:23643075-23643097 CGGGGTAAGAAGAGGAAGGAAGG + Intronic
927511456 2:23646675-23646697 CAGTGCCAGAATAGGAAGGGAGG - Intronic
927891148 2:26750301-26750323 GATTAGTAAAAGAGGAAGGAAGG + Intergenic
928432337 2:31231120-31231142 GAGAGGTGGAAGGGGAAGGAGGG - Intronic
928648667 2:33382451-33382473 ACCAGGTAGAAGAGGAAGGAAGG - Intronic
928669408 2:33585350-33585372 CCGTGGCAGAAGAGGCAAGATGG - Exonic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
930370599 2:50496401-50496423 AAGTGTTAGAAAAGGATGGAGGG - Intronic
931216288 2:60248023-60248045 AAGTGTTAGAGGAGGAAGGAAGG + Intergenic
932086897 2:68770506-68770528 CAGCGGCAGAAGATGAAGAAAGG + Intronic
932413229 2:71559391-71559413 GAGGGGTGGGAGAGGAAGGAAGG - Intronic
932574215 2:72954054-72954076 ATGTGGTAGACGAGGCAGGAAGG - Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933478182 2:82819212-82819234 GAGTGGTATAAGAGTGAGGATGG - Intergenic
933975041 2:87502672-87502694 GAGTGGTGGAATATGAAGGATGG + Intergenic
935369725 2:102332646-102332668 TTGTGGTGGAAGAGGAAGAATGG + Intronic
935874821 2:107494866-107494888 CAGAGGAAAAAGGGGAAGGATGG + Intergenic
936282313 2:111152750-111152772 CATTGGGAGAAGAGGAGGGGAGG - Intronic
936318785 2:111448142-111448164 GAGTGGTGGAATATGAAGGATGG - Intergenic
936564350 2:113571609-113571631 CAGTGCCAGAAGAGGAAGTCAGG + Intergenic
937275103 2:120679163-120679185 CAGGGGAGGAAGAGGAAGCAGGG - Intergenic
937786292 2:125903421-125903443 CAGTGAAAGAAGAGGAAGTAAGG + Intergenic
937992356 2:127671730-127671752 CAGAAGTAGAAGAAAAAGGAAGG + Intronic
938323388 2:130380727-130380749 AAGTGGGAGGCGAGGAAGGAGGG + Intergenic
938371525 2:130771641-130771663 CAGGGGTAGGGGTGGAAGGAAGG - Intergenic
939121949 2:138127612-138127634 AAGAAGGAGAAGAGGAAGGAAGG - Intergenic
940556926 2:155240588-155240610 GAGAGGGAGAAGGGGAAGGAGGG - Intergenic
941498832 2:166242812-166242834 CAAAGTTAGAAGATGAAGGAAGG - Intronic
941638113 2:167957995-167958017 CCCAGGTAGCAGAGGAAGGAGGG - Intronic
942017772 2:171833751-171833773 CAGAGGGAGAAGAAGATGGAGGG - Intronic
942266633 2:174234046-174234068 AAGTGGAAGGAGAGGAAGGAGGG - Intronic
942570907 2:177313364-177313386 AAGGGAAAGAAGAGGAAGGAAGG - Intronic
942970457 2:181951849-181951871 CAGTTGCAGAAGAGGGAGTAAGG - Intergenic
943736606 2:191363462-191363484 CTGTGGTTGAAGTGGAAGTAGGG + Intronic
943809297 2:192164189-192164211 AAGTGGTAGAAGAGGAGAGTAGG - Intronic
944732642 2:202533186-202533208 AGGTGAGAGAAGAGGAAGGAAGG - Intronic
944846254 2:203671213-203671235 CAGTGGTAGCAGAAGAACAATGG - Intergenic
946138514 2:217667991-217668013 AAGTGGGAAAAGAGGAAGGTGGG + Intronic
946170371 2:217891796-217891818 CACTGAGAGAAGAGGAAGGATGG - Intronic
946404763 2:219486477-219486499 CAGTGAGAGAAAAGGATGGAGGG + Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947978367 2:234386978-234387000 TAGTGGAAAAAAAGGAAGGAAGG + Intergenic
948303002 2:236922378-236922400 CAGTGGATGGAGAGGAAGGTTGG + Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169396434 20:5234871-5234893 CAGTGATAGAAAGGGAGGGAGGG + Intergenic
1169765595 20:9144710-9144732 AAGGGGAAGAAGGGGAAGGAGGG + Intronic
1169793678 20:9438617-9438639 CAGGTGGAGAAGAAGAAGGAGGG + Intronic
1170278433 20:14619341-14619363 GAGAGGAAGAAAAGGAAGGAAGG + Intronic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1171305216 20:24099489-24099511 CAGTGAGGGAAGAGTAAGGAGGG - Intergenic
1172017700 20:31888208-31888230 CAGTGGTAGTATAGCCAGGAGGG - Intronic
1172043351 20:32061743-32061765 GAGTTGAAGAAGAGCAAGGAGGG + Intronic
1172427152 20:34863203-34863225 GAGTGGTAGAAGGGGAGAGAGGG - Intronic
1172875097 20:38159204-38159226 GAGTGAAAGAAGAGGAAAGAAGG + Intronic
1172979416 20:38929519-38929541 TAGTGGTAGGAGAGGAAGCTGGG + Intronic
1173027723 20:39325039-39325061 CAGAGGTCTCAGAGGAAGGAAGG + Intergenic
1173087724 20:39940303-39940325 CATTAATAGAAGAGGAAGCAGGG + Intergenic
1173167837 20:40698547-40698569 GGGTGGTAGAAGAGGTAGAATGG - Intergenic
1173365577 20:42381658-42381680 GAGTGGAAGAAAAGGAGGGAGGG + Intronic
1173654101 20:44687372-44687394 CAGTCTTAAAAAAGGAAGGAAGG - Intergenic
1173755367 20:45511153-45511175 CAGTGGTAGATGAGGAACCAAGG - Intergenic
1173841811 20:46162411-46162433 AAGAGATAGAAGAGGTAGGAAGG - Intergenic
1173952263 20:47002681-47002703 GAATGGTAGAGGAGGAAGAAAGG - Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174641765 20:52050442-52050464 CAGAAGGAGAAGAGGAAGAAGGG - Intergenic
1174642484 20:52056510-52056532 CAGAGAAAGAAGAGTAAGGAAGG + Intronic
1175573466 20:60041687-60041709 GATTAGTAAAAGAGGAAGGAAGG - Intergenic
1175709319 20:61206450-61206472 CAGCAGAAGAACAGGAAGGAAGG + Intergenic
1176206985 20:63894620-63894642 CAGTGGTTGGACAGGAAGGAAGG + Intergenic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1176810242 21:13529104-13529126 CAGTTCCAGAAGAAGAAGGAGGG + Intergenic
1177066658 21:16445282-16445304 CAGTTGTAAAAAAGAAAGGAAGG - Intergenic
1177184627 21:17780125-17780147 CAGTGGGGGAAAGGGAAGGAGGG - Intergenic
1178805350 21:35834650-35834672 CAGAGGTAGAAGAGGAAGAGGGG - Intronic
1179638327 21:42729520-42729542 CAATGATAGCAAAGGAAGGAAGG - Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180304720 22:11065348-11065370 CAGTGGGAGAAGGGTAAAGAGGG - Intergenic
1181119526 22:20656710-20656732 GAGTGGTAGAAAAGGAAGCAGGG - Intergenic
1181400927 22:22649857-22649879 GATTAGTATAAGAGGAAGGAAGG - Intergenic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181534896 22:23536498-23536520 GATTAGTAAAAGAGGAAGGAAGG + Intergenic
1181575207 22:23789799-23789821 CAGTGATAGTAGTGGATGGACGG + Intronic
1181702905 22:24630949-24630971 GATTAGTATAAGAGGAAGGAAGG - Intergenic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1182052584 22:27324416-27324438 AGGTGGGAGAAAAGGAAGGAGGG + Intergenic
1182958511 22:34450092-34450114 GAGTGGTAGAGGAAGAGGGAAGG + Intergenic
1184170908 22:42759246-42759268 GAGTGGAAGAGGAGGAAGGCAGG + Intergenic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
1185286829 22:50004760-50004782 CTGAGGTAGGAGAGGAAGGGAGG + Intronic
949096755 3:95512-95534 CAAAAGTAGAAGAGGAAGGCAGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949601239 3:5600220-5600242 CAGAGGAAGAATAGGAGGGAGGG - Intergenic
950406105 3:12805967-12805989 CAGTGCTATAGGAGGTAGGATGG + Intronic
950528158 3:13536619-13536641 CAGTGGAAGGACAGGAAGGAGGG - Intergenic
950582054 3:13868870-13868892 CAGAGGGAGAGAAGGAAGGAGGG + Intronic
950699317 3:14729237-14729259 CTGTGGTAGAGGATGAGGGAAGG + Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
952190985 3:31023474-31023496 CAGTGGAACAGGAGGAAGGGAGG - Intergenic
952415749 3:33090294-33090316 CAGGGGTAGCTGAGAAAGGATGG + Intronic
952559921 3:34579901-34579923 CAGTGGTAGGAAAGGAATTATGG - Intergenic
952954355 3:38548001-38548023 GAGTGGTAGCAGAGGACCGAGGG - Intergenic
952999877 3:38922907-38922929 CACTGATAGAAGAGAAAAGAAGG + Intronic
953134357 3:40169984-40170006 AAGTGGAAGAAGAGCCAGGATGG + Exonic
954619108 3:51985718-51985740 GAGTGGTGGGAGAGGAAAGACGG - Intronic
955641190 3:61086911-61086933 GAGTGGTAGGAGATGATGGAGGG - Intronic
956248648 3:67212745-67212767 CAAAGATAGAAGAGAAAGGAAGG - Intergenic
956359157 3:68428175-68428197 CAGAGGGAGAGGAGGAAGGAAGG + Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957227273 3:77465948-77465970 CAGCAGGAGAAGAGGAAGCAAGG - Intronic
957692412 3:83589046-83589068 GAGTGGGAGAAGAAAAAGGAAGG - Intergenic
958524248 3:95233366-95233388 CAGCAGTAGGAGAGAAAGGAAGG - Intergenic
959515640 3:107263798-107263820 CAGTGGTAAAAGATGACGAACGG - Intergenic
960224747 3:115156641-115156663 AAGAAGTAGAAGAGGCAGGAAGG - Intergenic
960241188 3:115343905-115343927 CATTGGTGGAACACGAAGGAGGG + Intergenic
960273419 3:115699357-115699379 TGGTGGGGGAAGAGGAAGGAAGG - Intronic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961745024 3:129059279-129059301 CAGAGGCTCAAGAGGAAGGAGGG + Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962238602 3:133730838-133730860 GAGTGGTAGAAGTGTAGGGATGG + Intergenic
962842930 3:139251979-139252001 CAGGGGAAGAAGAGAAAAGAGGG + Intronic
963785770 3:149533007-149533029 TAGAGGGAGCAGAGGAAGGAAGG - Intronic
964672164 3:159238631-159238653 CAGAGGTTGCTGAGGAAGGAGGG + Intronic
964806472 3:160615514-160615536 CAGTGGTAAAATAGTAAGAATGG + Intergenic
964863652 3:161230056-161230078 CAGTGGTTGAAGGGGAAGTTGGG + Intronic
965910496 3:173769315-173769337 CAATGGTGGAAGATGAGGGATGG - Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966878084 3:184335039-184335061 AAGTGGCTGAAGAGGCAGGATGG + Exonic
966891889 3:184413250-184413272 GAGGGGTTGAAGAGGAAGGATGG - Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967491190 3:190092807-190092829 CGGATGTAGAATAGGAAGGAAGG - Intronic
967539065 3:190643378-190643400 CAATGGTAAATGAGAAAGGAAGG + Intronic
967971702 3:195004167-195004189 AGGAGGTAGAAGAGGAGGGAAGG + Intergenic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
967975226 3:195030757-195030779 CAGTGCTAGGAGTGGACGGAAGG - Intergenic
968470599 4:780784-780806 CAGTTGTAGGAGAGGAATAATGG - Intergenic
968477608 4:819708-819730 CACAGCTAGAAGAGGAAGGTGGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969294897 4:6263988-6264010 AAGTGGGAGAGGACGAAGGAGGG + Intergenic
970342658 4:15122582-15122604 AAGTGATAAAACAGGAAGGATGG - Intergenic
970504499 4:16713716-16713738 TAGTGGGACAAGAGGAGGGATGG + Intronic
970536881 4:17038977-17038999 GTGTGGCAGAAGGGGAAGGAGGG - Intergenic
970710465 4:18856146-18856168 CAGTAGTAGATGAAGAAGTAAGG + Intergenic
970814262 4:20135419-20135441 TAGTGGTATAAGAGGATGGGAGG - Intergenic
970914994 4:21322027-21322049 CAGAGGCAGGGGAGGAAGGAAGG + Intronic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
971833537 4:31731844-31731866 CAGTTTTAGAAAAGGAAGGAAGG - Intergenic
972587556 4:40451862-40451884 CAAGGGTAGATGAAGAAGGAAGG + Intronic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
972968718 4:44545602-44545624 CAGTAGTGGGAAAGGAAGGAAGG - Intergenic
972970369 4:44567271-44567293 CAGAAGGAGAAGAGGAAGCAAGG - Intergenic
973032784 4:45364750-45364772 AAGTGGTAAAAGAGGAGGGCTGG + Intergenic
973599568 4:52528672-52528694 AAGAGAGAGAAGAGGAAGGAAGG + Intergenic
973610610 4:52632869-52632891 CAGAGAAAGAAAAGGAAGGAAGG + Intronic
974020529 4:56688258-56688280 GAGAGGGGGAAGAGGAAGGAAGG + Intergenic
974080704 4:57209461-57209483 CATGGGTAGAAGAGAAAAGACGG - Intergenic
975669244 4:76763618-76763640 CAGTGGGAGATGAGGCTGGAAGG + Intronic
975916801 4:79334927-79334949 GGGTGGTAGTAGAGGAAGAATGG + Intergenic
976087176 4:81418416-81418438 GAGTGGTAGTTGGGGAAGGAGGG - Intergenic
976428859 4:84938866-84938888 CATTGGAAGAAGAGGAGGAAAGG - Intronic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
977058534 4:92225180-92225202 CAGCTGTTGAATAGGAAGGAGGG + Intergenic
977493684 4:97746657-97746679 CAGTGGAATAAAAGAAAGGAGGG + Intronic
977591215 4:98829230-98829252 GAGTGGTAGGAGGTGAAGGAAGG + Intergenic
978292817 4:107165591-107165613 CAGTGGCTGAGAAGGAAGGAGGG + Intronic
978497357 4:109374743-109374765 AGGAGGAAGAAGAGGAAGGAAGG + Intergenic
978949114 4:114536095-114536117 AAGTGGAACAAAAGGAAGGAAGG - Intergenic
979548980 4:121969143-121969165 CAGTGGAAGAAAAGGAAGGAGGG - Intergenic
979717142 4:123853661-123853683 CAGGGGTAGAAAAGGAGGCAAGG - Intergenic
980093544 4:128466633-128466655 CAGTGGAAGAAGAAGAAGATAGG + Intergenic
980175795 4:129342556-129342578 CATTGGAAGAAAAGGAAGAATGG + Intergenic
980400885 4:132284514-132284536 TAGTGAGAGAGGAGGAAGGAAGG + Intergenic
980807098 4:137828178-137828200 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980807110 4:137828216-137828238 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980884999 4:138752640-138752662 CTGGGGTGGAGGAGGAAGGAAGG - Intergenic
980902088 4:138914754-138914776 CAGAGGTAGAAAAACAAGGATGG + Intergenic
981054598 4:140347433-140347455 GAGTGGAAGCATAGGAAGGAAGG - Intronic
981101236 4:140831577-140831599 GAGAGGTAGAAAGGGAAGGATGG - Intergenic
981113916 4:140967874-140967896 CTGTGGTAAGAGGGGAAGGAAGG + Intronic
981233210 4:142383767-142383789 CAGTGGTTGCACAGGCAGGAGGG + Intronic
981308549 4:143272181-143272203 CAATGGTAGAAGAGGGCCGAGGG - Intergenic
981328888 4:143484815-143484837 TAGTGTTGGAAGAGGAAGAAGGG - Intergenic
981559633 4:146033055-146033077 CAGGGGTAGAAGAAGCAGCAAGG + Intergenic
981624735 4:146742673-146742695 GAGGAGTAGAAGAGGAAAGAAGG - Intronic
981688746 4:147482699-147482721 CATTGTTGGAGGAGGAAGGAAGG + Intronic
981921019 4:150084852-150084874 CAGTGGTAGCATGGGCAGGAAGG - Intronic
981938908 4:150261083-150261105 AAGTGGTAGAAAATGAAGGGTGG - Intergenic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
982018647 4:151181325-151181347 CAGGGGTGGAAGTGGAAGGTGGG + Intronic
982240646 4:153296256-153296278 AAGAGGAAGAAGAGAAAGGAGGG - Intronic
982509217 4:156260161-156260183 AAGTTATACAAGAGGAAGGAAGG + Intergenic
983120176 4:163873719-163873741 CAGTCCAAGAACAGGAAGGAAGG - Intronic
983438942 4:167755858-167755880 CAGAGGAAGAAAATGAAGGAAGG - Intergenic
983595114 4:169457654-169457676 CAGGGGGAGAGAAGGAAGGAAGG + Intronic
984830410 4:183967457-183967479 GAGTGGTGCAAGAGGAAGAAAGG + Intronic
984908886 4:184653338-184653360 TAGTGGGAGAAGAGGCAGCAGGG - Intronic
984943487 4:184953648-184953670 CAGCGTGAGAAGAGGAAGAATGG + Intergenic
985721926 5:1493989-1494011 CAGAGGAGGAAGAGGCAGGAAGG + Intronic
985917044 5:2930147-2930169 CAGTGGGAGAGGAGAAAGCAAGG - Intergenic
985958064 5:3279049-3279071 GAATGGGAGGAGAGGAAGGAGGG - Intergenic
986073805 5:4313690-4313712 CAGTGGAAGAAAAGGAAAGCAGG - Intergenic
986240436 5:5955171-5955193 CAAGGGGAGAAGGGGAAGGAGGG - Intergenic
986285085 5:6353403-6353425 CAGAGCTGGAAGAGGCAGGAAGG + Intergenic
986487630 5:8255102-8255124 GAGGGGGTGAAGAGGAAGGAAGG + Intergenic
986532040 5:8747750-8747772 CAGAGAAAGAAGAGAAAGGATGG - Intergenic
986748910 5:10767655-10767677 ACGTGAAAGAAGAGGAAGGAGGG - Intergenic
986989468 5:13535055-13535077 CACTGGTAGGAGTTGAAGGAAGG - Intergenic
987025949 5:13926445-13926467 AAGGGGTAGAAGACGAAGGTAGG + Intronic
987729660 5:21752732-21752754 TAGAGGAAGTAGAGGAAGGAAGG + Intronic
988243506 5:28645811-28645833 CAATAGTAAAAGAGGAGGGAGGG + Intergenic
988518123 5:31922577-31922599 CAGAGGGAGACAAGGAAGGAAGG + Intronic
988786572 5:34570727-34570749 CAGTGGGAAGAGAGGAAGGGCGG + Intergenic
989187879 5:38642666-38642688 CACTGGGAGAGGAGGACGGAGGG - Intergenic
989294962 5:39814566-39814588 GGGAGGTAGAAGAGGAAAGAGGG + Intergenic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989331360 5:40262803-40262825 GAGGGAAAGAAGAGGAAGGAAGG + Intergenic
989979162 5:50621657-50621679 GAAAGGAAGAAGAGGAAGGAAGG + Intergenic
990631384 5:57674292-57674314 CAGAGGGAGAGAAGGAAGGAGGG - Intergenic
991084855 5:62639394-62639416 CACAGGAAGAAGAGGAAGTATGG + Intergenic
992792795 5:80228305-80228327 GAGGGGGAGAGGAGGAAGGAAGG + Intronic
993846682 5:92953280-92953302 CTGTGGTAGTAGAGGTAGGTTGG + Intergenic
994658224 5:102620866-102620888 AAGTGGTAGGAAAGGATGGAGGG - Intergenic
994960495 5:106595541-106595563 CAGTGGTGGAAGAGGAGGAAGGG - Intergenic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
997444888 5:133933723-133933745 CAGGGAAAGAAGAGGAATGAAGG - Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
997801609 5:136868303-136868325 CAAGGGCAGAAGAAGAAGGATGG - Intergenic
998826533 5:146107234-146107256 GAGGGGCAAAAGAGGAAGGAGGG + Intergenic
998895357 5:146792997-146793019 CAGTGGTAAAAGTGGAAGCAGGG + Intronic
999017973 5:148129169-148129191 CAGCTGTAGAAGAGGAAGTCAGG + Intronic
999090510 5:148931949-148931971 TAGTGGCAGAATAGGGAGGAAGG - Intronic
999204259 5:149836872-149836894 CAGAGGAGGAAGAGGAAGAAGGG + Exonic
999979657 5:156945600-156945622 CAGTGGGAAGAGAGGAAGTAGGG + Intronic
1000343557 5:160295739-160295761 AAATGATAGAAGAGCAAGGAAGG + Intronic
1000956406 5:167549028-167549050 GAGAGGCAGGAGAGGAAGGACGG - Intronic
1001320934 5:170680906-170680928 GAGGGGTAGGAGTGGAAGGAAGG + Intronic
1001398888 5:171435146-171435168 GAGTGGTGGGAGAGGAAGGTGGG + Intronic
1001546626 5:172574463-172574485 GAGGGGAAGGAGAGGAAGGATGG - Intergenic
1001779586 5:174356392-174356414 TAGAGGAAGAAGAGGAAGGGAGG - Intergenic
1002101164 5:176858351-176858373 CACTGGACAAAGAGGAAGGAAGG + Intronic
1002949364 6:1793937-1793959 TAATGGTAGAAGTGGAATGATGG + Intronic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003373661 6:5553247-5553269 CAGGAGTAGATGAGGATGGATGG + Intronic
1003493411 6:6642913-6642935 CAGAGGACGAAGAGGAAGGTGGG - Intronic
1004292698 6:14382940-14382962 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
1004566336 6:16801454-16801476 GAGAGGAAGAAGGGGAAGGAAGG - Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005159596 6:22843595-22843617 CAGAGGGCAAAGAGGAAGGAGGG - Intergenic
1006383306 6:33714081-33714103 GAGTGGGAGAAGATCAAGGATGG + Intergenic
1007065554 6:38987299-38987321 AAGAAGTAGAAGAGGAAGAAAGG - Intronic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007717887 6:43867816-43867838 CATTGGGAGAAAAGGAGGGAGGG - Intergenic
1007743885 6:44030435-44030457 CAGTCATTTAAGAGGAAGGAAGG - Intergenic
1008075601 6:47142514-47142536 GAGTGGAAGAGGAGTAAGGAAGG - Intergenic
1008121610 6:47622954-47622976 AATTGGTAGAAGAGGGAGTAGGG - Intronic
1008475539 6:51931928-51931950 AAGAGGGAGAAGAGGAAGGGAGG + Intronic
1008870350 6:56265454-56265476 AAGTGGAATAGGAGGAAGGACGG - Intronic
1010335569 6:74678913-74678935 AAGAGAAAGAAGAGGAAGGAAGG - Intergenic
1010567259 6:77431384-77431406 AAGTTGCAGAAGAGGAAAGATGG - Intergenic
1010682392 6:78811907-78811929 CAGTAGTTGAATAGGAAGGAAGG + Intergenic
1010732117 6:79402298-79402320 CATTGGGAGAAGAGGAAGAAAGG + Intergenic
1010823783 6:80448255-80448277 AAGTGGTGGAAGATGAAGTAAGG + Intergenic
1011488904 6:87871083-87871105 AAGGGGTTGAAAAGGAAGGAGGG + Intergenic
1011730197 6:90254478-90254500 CAAAGGTAGTAGAGGAAGGTGGG + Intronic
1012272263 6:97228229-97228251 GAGAGGTAGCAGGGGAAGGAAGG + Intronic
1012798320 6:103792194-103792216 TGGTGGTAGAGCAGGAAGGAAGG - Intergenic
1012981100 6:105831135-105831157 CAGTGGAAGGAGGGGAAGGGGGG + Intergenic
1013054433 6:106569638-106569660 CACTTGTAGATGAGTAAGGATGG - Exonic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014465200 6:121748535-121748557 GACTGGTAGTAGAGGAAGGGAGG + Intergenic
1014481501 6:121944015-121944037 GAGAGGTAGAAAAGGAAGGATGG - Intergenic
1014494388 6:122102339-122102361 AAGTGGGGGAGGAGGAAGGAAGG + Intergenic
1014697008 6:124635025-124635047 GAAAGGAAGAAGAGGAAGGAAGG + Intronic
1015208880 6:130672788-130672810 CAGTGGAAGAAGGCCAAGGATGG - Intergenic
1015452024 6:133380934-133380956 GAGAGGGAGAAGAGGAAGAAAGG - Intronic
1015589611 6:134810437-134810459 CAGAGAAAGAAGAGGAGGGAGGG - Intergenic
1016056639 6:139584818-139584840 CAGAGGCAGAAGAGGTGGGAGGG + Intergenic
1016216965 6:141616477-141616499 CAGTGGTAGCTCAGAAAGGAGGG - Intergenic
1016356538 6:143224716-143224738 CATTGTTATAACAGGAAGGAAGG - Intronic
1016731378 6:147431882-147431904 AAATGGGAGAAGAGGAAGGGGGG - Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017484012 6:154886088-154886110 CAGTGGTCCAGGAGGCAGGAAGG + Intronic
1017665118 6:156712564-156712586 AAGAGGAAGAGGAGGAAGGAAGG + Intergenic
1017856978 6:158358185-158358207 CAGGGGTGCAAGTGGAAGGAGGG + Intronic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019074371 6:169376206-169376228 AAGTGGTAGAAGGGGAGAGATGG - Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019196797 6:170287901-170287923 GAGAGGGAGAGGAGGAAGGAAGG - Intronic
1019231911 6:170573391-170573413 AAGAGGCAGAAGAGAAAGGAAGG - Intergenic
1020353845 7:7255354-7255376 CAGCTATAGAAGAGAAAGGAGGG + Intergenic
1020969889 7:14923007-14923029 CTGTGGTGGAAAAGGAGGGATGG - Intronic
1021508872 7:21413960-21413982 AAGAGGTGGAAGAGGAACGATGG - Intergenic
1022114996 7:27253258-27253280 CCGGGGTAGAAGAGGAGGCAAGG + Intergenic
1022365908 7:29716235-29716257 AAGTGGTAGAAATGGAAGAAAGG - Intergenic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1023130457 7:36997740-36997762 CAGTGGTAGGAGAGGAAAAGAGG + Intronic
1023278995 7:38550681-38550703 GAGTGGTGGGAGAGGGAGGAGGG - Intronic
1023340504 7:39214321-39214343 CAGGGGAGGAGGAGGAAGGAAGG - Intronic
1023659903 7:42460685-42460707 CATTGTCAGAAGAGGAATGATGG - Intergenic
1023981094 7:45070454-45070476 CAGTGGCAGATGGGGAAGAATGG + Intronic
1023996421 7:45161669-45161691 GAGAGGAAGAAGGGGAAGGAGGG + Intronic
1024037123 7:45516633-45516655 CAGTGTCAGAAGTGGTAGGAAGG + Intergenic
1024514766 7:50237325-50237347 CAGAGGTAAAAGATGAGGGAGGG - Intergenic
1024708261 7:51985535-51985557 CAATGGTAGAAAAAGAAGAAAGG - Intergenic
1024721396 7:52140828-52140850 GAGTGGTAGAAGAGGTCAGAGGG - Intergenic
1025965090 7:66262326-66262348 CAATGAAAGAAGAGGAAGGGAGG - Intronic
1026205680 7:68255344-68255366 AAGACGAAGAAGAGGAAGGAAGG - Intergenic
1026325668 7:69307074-69307096 CAGTGGCAGAGGAAGAGGGAGGG + Intergenic
1027947702 7:84770274-84770296 CAGTGGTACAATGGGAAGAAAGG - Intergenic
1028144215 7:87304187-87304209 CAGTGGTTGCAGAGCATGGAGGG + Intergenic
1028477297 7:91265727-91265749 AAGTGGTAGTTGAGGTAGGAGGG - Exonic
1028520216 7:91721371-91721393 CAGTGGTGGAAGTGGCAGGTTGG - Intronic
1028606156 7:92658044-92658066 TAGTGGTAGAAAAGGTAGCAAGG + Intronic
1029827777 7:103218592-103218614 AAGTGGTAGAAATGGAAGAAAGG + Intergenic
1029853667 7:103490774-103490796 TGCTGTTAGAAGAGGAAGGAAGG + Exonic
1030005505 7:105114563-105114585 CAGAGGTAGAAGACAAAGGCTGG - Intronic
1030161000 7:106508480-106508502 CAGTGGCAGAGGAAGAAGGGGGG + Intergenic
1030174345 7:106636014-106636036 GAGAGGGAAAAGAGGAAGGAAGG + Intergenic
1030175534 7:106649690-106649712 AAGAGGAAGAAGAAGAAGGAAGG + Intergenic
1030974053 7:116098857-116098879 GAGAGGAAGAAAAGGAAGGAAGG + Intronic
1031873290 7:127110367-127110389 CAGTGGTAGAGAAGGCTGGAAGG - Intronic
1032403895 7:131642150-131642172 TAGTGGTAGGAGTGGAGGGAAGG + Intergenic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1033605899 7:142928530-142928552 CAGTGATGGAATAGGAAGCAAGG + Intronic
1033832609 7:145271598-145271620 GAGGGGAGGAAGAGGAAGGAAGG + Intergenic
1033969678 7:147024772-147024794 CAGTGGATGAAGAGGAATCATGG + Intronic
1034015939 7:147586512-147586534 CAGAGAGAGAAGAGGAAGGAAGG + Intronic
1034187263 7:149187904-149187926 CAATGGGAGAAGTGGAAGTATGG + Intergenic
1034240347 7:149605954-149605976 CAGAGGTTGAAGGGGAGGGATGG - Intergenic
1034270005 7:149798808-149798830 CAGGGGCTGGAGAGGAAGGAGGG + Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034336213 7:150325148-150325170 AAGTGGAAGAGGAGGAATGATGG - Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036626048 8:10472409-10472431 AAGTGGTAGAACAGGTAGGGAGG - Intergenic
1037418526 8:18677177-18677199 CAGAGGAACTAGAGGAAGGAGGG + Intronic
1037539830 8:19860365-19860387 CATTGGTAGAACGGGAAGGAGGG - Intergenic
1037555464 8:20017992-20018014 CAGTGGTAGCAGAGGAGGTTAGG + Intergenic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1037838127 8:22226651-22226673 CAGTGAGAGAAGAGAAAGGTTGG + Intronic
1038279169 8:26148094-26148116 CTGTGGTAGATGAGGAGGGCTGG + Intergenic
1038459872 8:27706743-27706765 CAGTGGAAGAAGAGGAGGCTTGG + Intergenic
1039272767 8:35900849-35900871 CACGGGAAGAAAAGGAAGGATGG - Intergenic
1040725358 8:50376059-50376081 CACTGGTAGAAGGAGAAGGCAGG + Intronic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1041603616 8:59753510-59753532 GAGTGGTGGAAGGGGAATGAGGG + Intergenic
1041880332 8:62742374-62742396 TACTGGTAGAGAAGGAAGGAGGG + Intronic
1042165106 8:65937768-65937790 AAGTGAGAGAGGAGGAAGGAAGG - Intergenic
1042631826 8:70825844-70825866 CAGGGGTAGAGGAAAAAGGAAGG - Intergenic
1042939735 8:74095671-74095693 CAGCAGCAGAAGAGGTAGGAGGG - Intergenic
1042985017 8:74573876-74573898 CAGTTTTTGAATAGGAAGGATGG - Intergenic
1043982782 8:86660088-86660110 CAGTTGTAGAGGAGAAAGCATGG + Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044655832 8:94547443-94547465 CAGGGATAGAAGAATAAGGAAGG - Intronic
1044801904 8:95965669-95965691 CAGGGGTGGAAGGGGAAGGGAGG + Intergenic
1045367055 8:101486070-101486092 CAGTGATAGAAGAGTAAGGAAGG - Intergenic
1045686974 8:104722407-104722429 CCATGGTGGAAGAGGAAGCAAGG - Intronic
1045748667 8:105455460-105455482 GAGTGGTATAAGATGAAGCAGGG + Intronic
1047054885 8:121152998-121153020 CAGAGGAAGAAGAGGTAGAAGGG - Intergenic
1047574056 8:126133515-126133537 CAGTGGTGGCAGTGGAAGGTGGG - Intergenic
1048053976 8:130846563-130846585 GAGGGGAAGAAGGGGAAGGAAGG - Intronic
1048249903 8:132855426-132855448 GAGGGGAAGAAGAGAAAGGAAGG - Intergenic
1048530082 8:135240001-135240023 CAGAGGTAGAAGAGGAGATATGG - Intergenic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1049443537 8:142619771-142619793 CAACAGGAGAAGAGGAAGGAAGG - Intergenic
1049679268 8:143910308-143910330 CAGGGGTGAAAGAGAAAGGAGGG - Intergenic
1049888075 9:41599-41621 CAGTGCCAGAAGAGGAAGTCAGG - Intergenic
1050037026 9:1447521-1447543 CATTGTTAAAAGAGGAAGGAAGG + Intergenic
1050197040 9:3096293-3096315 GAGAGGTATAAAAGGAAGGATGG - Intergenic
1050351197 9:4741874-4741896 CAGAGGAGGAGGAGGAAGGAGGG - Intronic
1051348584 9:16175723-16175745 CATTGGCAGAAGAGGATGGATGG + Intergenic
1051357823 9:16255556-16255578 TGGTGGTAGAAGTTGAAGGAGGG - Intronic
1051417980 9:16862756-16862778 GAGTAGTAGAAGAGAAAAGAGGG - Intronic
1051489709 9:17647915-17647937 CTGAGGTGGAAGAGGAAGGTGGG - Intronic
1051700908 9:19822935-19822957 GAGAAGGAGAAGAGGAAGGAAGG - Intergenic
1052325849 9:27216084-27216106 CAGGGTTGGAAGAGGAAGCAAGG + Intronic
1052792829 9:32892207-32892229 CAGCGGTAGCCCAGGAAGGAGGG - Intergenic
1053153699 9:35758963-35758985 GGGTAATAGAAGAGGAAGGAAGG - Intergenic
1053476841 9:38388329-38388351 CAGTGGGAGAAGAGACAGGCAGG + Intergenic
1053836701 9:42144500-42144522 CAATGATAAAAGAGAAAGGAAGG + Intergenic
1054714840 9:68547028-68547050 GAGTGGGGGAAGAGGAGGGAGGG - Intergenic
1055486510 9:76761225-76761247 CAATGGTGGAGGAGGAAGAAAGG - Intronic
1055522100 9:77091746-77091768 TACTGGTAGAAGAGTAGGGAAGG + Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1056382983 9:86072180-86072202 CAGTGGTTGTACAGGCAGGAGGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057006171 9:91562171-91562193 CAGTGTCAAAAAAGGAAGGAAGG + Intergenic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1058139321 9:101341169-101341191 CAGAGGTAGAAGAGGATCAAGGG + Intergenic
1058957011 9:109958688-109958710 GAGAGGAAGGAGAGGAAGGAAGG + Intronic
1059097227 9:111431145-111431167 TACTGGTAGATAAGGAAGGAGGG - Intronic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1060480991 9:124016832-124016854 GGGTGGTAGGAGAGGAGGGATGG - Intronic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1061111215 9:128572680-128572702 AAGTGGTAGCAGAGGAAGGTGGG + Intronic
1061251474 9:129428874-129428896 CATGGGTGGAAGGGGAAGGAGGG - Intergenic
1061853422 9:133429048-133429070 GAGAGGTAGGACAGGAAGGAGGG - Intronic
1062081914 9:134628629-134628651 CACTGGGAGAAGAGGAGGGCTGG - Intergenic
1062717216 9:138017259-138017281 CAGAGTTAGGAGTGGAAGGAAGG - Intronic
1185935545 X:4253263-4253285 CAGTGGAAGAACAGGAAGTGTGG + Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186684133 X:11906811-11906833 GAGTGCTAGAAGAAGAAAGAAGG - Intergenic
1186873852 X:13797982-13798004 GAGTGGGAGCATAGGAAGGATGG + Intronic
1187097709 X:16164981-16165003 GGGTGGAGGAAGAGGAAGGAAGG - Intergenic
1187284918 X:17896049-17896071 CAGTGGTAGGAGATGAGTGAAGG + Intergenic
1187498142 X:19814143-19814165 GTGTGGCAGGAGAGGAAGGAGGG - Intronic
1189227221 X:39422961-39422983 CAGTGGTGGAGGTGGAAAGAAGG - Intergenic
1190123416 X:47682760-47682782 AAGAGGAAGAAGAGGAAGGAAGG - Intergenic
1190462774 X:50695089-50695111 CAGTGGCATAAGCAGAAGGAAGG - Intronic
1190535140 X:51418403-51418425 AAAGAGTAGAAGAGGAAGGAGGG - Intergenic
1191687790 X:63910404-63910426 CAGTGGTGGAAGGGAAAGAAGGG + Intergenic
1192097819 X:68231779-68231801 CAGAGGTAGAGGTAGAAGGAGGG + Intronic
1192102929 X:68284391-68284413 CAGTGGTGGCAGAAGAAGAAAGG - Intronic
1192447790 X:71223569-71223591 CAGTAGCAGGAAAGGAAGGATGG - Intronic
1193136005 X:77971171-77971193 GAGTGGTAGAAGAGGAGGCCAGG + Intronic
1193154495 X:78158387-78158409 CAGGGGTGGAAGAGGCAGCAGGG + Intergenic
1193398487 X:81014012-81014034 CAGTGGTTGAAGCCCAAGGAAGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195658796 X:107358702-107358724 CAGAGGGAGAGAAGGAAGGAGGG + Intergenic
1195997463 X:110745511-110745533 CAGATGTAGAAGAGGGAGGTGGG - Intronic
1196340097 X:114585004-114585026 GAGTGGGAGGAGAGAAAGGAGGG + Intronic
1197006412 X:121507332-121507354 CAGAGGTGGAAGAGGTAGAAGGG - Intergenic
1197161487 X:123327638-123327660 CAAAGGGAGAAAAGGAAGGAGGG + Intronic
1197658359 X:129142675-129142697 CAGTAATGGAAGAGGAATGAAGG + Intergenic
1197950479 X:131890662-131890684 CAGAGGAGGAAGAGGAAAGATGG - Intergenic
1198234147 X:134720758-134720780 AAGTGGCTGAAGTGGAAGGATGG - Intronic
1198243442 X:134807036-134807058 CATTGGGGAAAGAGGAAGGAGGG + Intronic
1198426780 X:136528750-136528772 CAGTGGGAGAAGAGCTGGGAAGG - Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1198810782 X:140534176-140534198 AGGTGGAAGAAGAGGAAGGAGGG + Intergenic
1199614100 X:149641640-149641662 CAGAGGAGGAAGAGGTAGGAGGG + Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200234723 X:154462730-154462752 CATGGGTAGGAGGGGAAGGATGG - Intronic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic