ID: 902079434

View in Genome Browser
Species Human (GRCh38)
Location 1:13811271-13811293
Sequence TGTGAAGGTTAAGGGGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902079434 Original CRISPR TGTGAAGGTTAAGGGGCCTC TGG Intronic
900483457 1:2910413-2910435 TGGGGAGGCTCAGGGGCCTCCGG + Intergenic
900527249 1:3135264-3135286 TGGGCAGGGTAGGGGGCCTCAGG + Intronic
900888178 1:5430154-5430176 TTTGAAGGGGAGGGGGCCTCAGG - Intergenic
901297341 1:8170568-8170590 AGTGATGGTCAAGGGGCATCCGG + Intergenic
902079434 1:13811271-13811293 TGTGAAGGTTAAGGGGCCTCTGG + Intronic
905607885 1:39319973-39319995 TGTTAAGTTTAAAGGGCCTACGG - Intronic
908484177 1:64573843-64573865 TGTGAAGATTAAAAGGCATCAGG + Intronic
916065359 1:161132155-161132177 TGTGAAGGGGAAGGGGGCTGTGG - Intronic
917154298 1:171979685-171979707 GGTGAAGGTTAAGGGGCCCCAGG - Intronic
920006015 1:202834347-202834369 TGCGGAGGTTAAGGGGCCTTGGG + Intergenic
920708441 1:208272543-208272565 TGTGAAGTTTCAGGGGCCGGAGG + Intergenic
920978439 1:210808441-210808463 CTGGAAGGTTAAGGGTCCTCAGG + Intronic
922130245 1:222770684-222770706 TGTGAAAGATAAGGGGCATAGGG + Intergenic
1062904732 10:1172125-1172147 TGTGAAGGAGATGGGGCCTGTGG + Intergenic
1064256322 10:13745561-13745583 TGTGAAGGGCGAGGTGCCTCTGG + Intronic
1066661988 10:37745881-37745903 TGTGATGCTAAGGGGGCCTCAGG + Intergenic
1069425773 10:68287564-68287586 TGGGATGGTGAAGGGGCCACAGG - Intronic
1074624882 10:115171776-115171798 TGTGAAGGTGAAGGTGTCTAGGG + Intronic
1075632244 10:124007373-124007395 TTTGAAGGTTAAGTGACCACAGG - Intergenic
1077454019 11:2667200-2667222 TGGAAAGGTTAGGGGGCCACGGG - Intronic
1078054300 11:7994727-7994749 TGTGAATGGTATGTGGCCTCTGG - Intronic
1085482129 11:76831303-76831325 TGTGAAGGGAAAGTGGGCTCTGG + Intergenic
1086994746 11:93343000-93343022 TGTGAAGTTTGAGGTGCCTCTGG + Intronic
1091720154 12:2807306-2807328 TGTGAATGTCAAGGGTCCTGTGG + Intergenic
1092844586 12:12572248-12572270 TGTCAAGTTCAAGGGGCCTATGG + Intergenic
1096141164 12:49243708-49243730 TGTGAAGGCTAAGAGGACTTGGG + Intronic
1097663778 12:62458057-62458079 TGTGAAGGGTAATGAGCCTTGGG + Intergenic
1098826036 12:75298289-75298311 TGTGAAGGGGTATGGGCCTCTGG - Intronic
1100194915 12:92234577-92234599 TGTGAAGGCAAAAGGGCCCCTGG + Intergenic
1100878574 12:98991041-98991063 TGTGATGGATGAGGGACCTCAGG + Intronic
1102089051 12:110171117-110171139 TGGGAAATTTTAGGGGCCTCAGG - Intronic
1105052280 12:133065335-133065357 TGTGAAAGTTAGAGGGCCTTTGG - Intergenic
1106287913 13:28334317-28334339 TTTGAAGGATGTGGGGCCTCAGG - Intronic
1117020517 14:51565702-51565724 TATGAAGGAAATGGGGCCTCAGG + Intronic
1120859965 14:89246348-89246370 TGGGAAGGTTAAAGGCCATCAGG + Intronic
1122296109 14:100706540-100706562 TGTGAAGGTGATGGGGCTTGGGG + Intergenic
1123056360 14:105572428-105572450 AGTGAAGGTTCACAGGCCTCGGG - Intergenic
1123057571 14:105579379-105579401 AGTGAAGGTTCACAGGCCTCGGG + Intergenic
1123080793 14:105692556-105692578 GGTGAAGGTTCACAGGCCTCGGG - Intergenic
1123081848 14:105699312-105699334 AGTGAAGGTTCACAGGCCTCGGG + Intergenic
1124887740 15:33702566-33702588 TGTCAAGTTTAAGGGGCCCCAGG + Intronic
1125285752 15:38090750-38090772 TGAGAAGGTTCAGGAGACTCAGG + Intergenic
1125415520 15:39448239-39448261 TGTGGAGGTTGGTGGGCCTCTGG - Intergenic
1125739660 15:41953184-41953206 GGTGAAGGTTAGGGGTCCTCTGG + Intronic
1126445493 15:48738961-48738983 TGTGAAGGTGAAGGAGGCTTTGG - Exonic
1128953160 15:71908671-71908693 TGTGAGGGTAAAGGGGCATATGG - Intronic
1129200433 15:73995199-73995221 TGAGAAGGGTCAGTGGCCTCCGG + Intronic
1130297977 15:82660516-82660538 TGTGAAGGTTTGGAGGCTTCAGG - Intronic
1130881823 15:88061881-88061903 TTTGATGGATAAGGGGCCTGAGG - Intronic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1133745396 16:8682631-8682653 AGTGAAGATTACGGGACCTCTGG - Intronic
1134208014 16:12253463-12253485 AGAGAAGGTTAAGGGGGCTCAGG + Intronic
1136381626 16:29898763-29898785 ATTGAGGGTTAAGGGGCTTCGGG + Intronic
1136656353 16:31711552-31711574 TGTGCTGGGTAAGGGGCCTAGGG + Intergenic
1139296935 16:65909411-65909433 AGTGAATGTGAGGGGGCCTCTGG - Intergenic
1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG + Exonic
1142355398 16:89599280-89599302 TGTGCAGGTCAGGGGGTCTCGGG + Intergenic
1142411727 16:89920449-89920471 TGGGGAGGTTGTGGGGCCTCAGG + Exonic
1143002397 17:3802836-3802858 TGTGAACGTCAGGGTGCCTCGGG + Intergenic
1145975060 17:28979079-28979101 TGTGGAGGTTGAGGAGCCTGTGG + Intronic
1146304681 17:31721931-31721953 TGAGAAGGTTATGGAGCCTAGGG + Intergenic
1146383782 17:32350895-32350917 CCTGAAGATTAAGGCGCCTCTGG - Intronic
1146749258 17:35362920-35362942 TGTGAAGGTTATCGGGCGTTGGG + Exonic
1148858373 17:50591393-50591415 GGTGAAGGTGCAGGGGGCTCAGG + Intronic
1151469543 17:74309563-74309585 TACAAAGGTTAAGGGGCCTGGGG + Intronic
1157271782 18:46281835-46281857 TGTGAAGATTAAGGGGCCGTTGG + Intergenic
1157616676 18:48991417-48991439 GATGTAGGTTGAGGGGCCTCAGG + Intergenic
1157623311 18:49028335-49028357 TGGAAATGTGAAGGGGCCTCTGG + Intergenic
1158746821 18:60209620-60209642 TGTGAAGGATAAGTAGACTCTGG - Intergenic
1159210789 18:65318768-65318790 TTTGAAGCTCAGGGGGCCTCTGG + Intergenic
1162402486 19:10454385-10454407 GGCAAGGGTTAAGGGGCCTCCGG + Intronic
1163777212 19:19225543-19225565 TTTCAAGGTTATGGGGCCTCCGG - Intronic
1164618146 19:29678740-29678762 TGGGAAGGTCAGGAGGCCTCGGG + Intergenic
1166278764 19:41775523-41775545 TGGGAAGGTGAAAAGGCCTCAGG - Intergenic
1167447033 19:49543666-49543688 TATGAAGGGTAAGGGGGCCCTGG + Intronic
928324376 2:30308076-30308098 TGTGAAGATTAAGTGGGATCAGG + Intronic
931634257 2:64327720-64327742 TGTGAGGGTCAATGGGCTTCAGG + Intergenic
943730032 2:191292734-191292756 TCTGATGGTTGAGGGGCCTTAGG + Intronic
946778056 2:223164582-223164604 AGTGATGGATAAGGGGCCTCAGG + Intronic
947570324 2:231228627-231228649 TCTGAAGGTGAGGGGGCCTTAGG - Intronic
948999207 2:241602778-241602800 TGTGTAGCTGTAGGGGCCTCCGG - Intronic
1171140155 20:22733962-22733984 TATGAAGGTGCTGGGGCCTCTGG - Intergenic
1172268586 20:33639006-33639028 TGAGAAGGTGGAGGTGCCTCTGG - Intronic
1173669653 20:44789868-44789890 TGTGAAGATTAATGGGCCCAGGG + Intronic
1174592932 20:51660821-51660843 TGTGTAGGTTAAAGGGCCTATGG - Intronic
1176000179 20:62828158-62828180 TGTGCAGGAGTAGGGGCCTCAGG + Intronic
1181458326 22:23071697-23071719 AGTGCAGGTGCAGGGGCCTCGGG + Intronic
1181537943 22:23556374-23556396 TGTGACAGTGAAGGGGCCCCAGG - Intergenic
1181802731 22:25358056-25358078 GGTGGAGGTTCTGGGGCCTCAGG + Intronic
1185086167 22:48742194-48742216 GGTGAAGGATGAGGGGCCTGTGG - Intronic
1185086182 22:48742237-48742259 GGTGAAGGATGAGGGGCCTGTGG - Intronic
955167774 3:56531333-56531355 TAAGAAATTTAAGGGGCCTCAGG + Intergenic
956760884 3:72443520-72443542 TGTGGAGGTTCAGGGGCAGCAGG - Intronic
957533682 3:81473459-81473481 TGAGCTGGTGAAGGGGCCTCAGG - Intergenic
964736395 3:159923002-159923024 TGTGATGGGTAAGGGGAGTCAGG + Intergenic
966677720 3:182607401-182607423 TCTGAAGATTGAGGGGCCACTGG + Intergenic
967850310 3:194077539-194077561 TGTGAAGGTTAAGGGGATATAGG - Intergenic
968890646 4:3366861-3366883 AGTGAAGGCAAAGGGGCCTGTGG - Intronic
969367892 4:6709962-6709984 CGTGCACGTAAAGGGGCCTCGGG + Intergenic
969618761 4:8268520-8268542 GCTGGAGGTTAAAGGGCCTCGGG - Intergenic
973712429 4:53642969-53642991 AGTCAATGTTAAGTGGCCTCTGG - Intronic
974107537 4:57487248-57487270 TGTGAGGGTTGAGGGGGCTTCGG - Intergenic
974908244 4:68083108-68083130 TGTCAAGGGTGAGGGGTCTCTGG - Intronic
977728801 4:100327537-100327559 TCTGAAGGCTAAAGGGCCACTGG + Intergenic
979026653 4:115586082-115586104 TGAGAATGTTCAGGGGACTCTGG + Intergenic
979493512 4:121357839-121357861 TGAAGAGGTTAAGGGGCTTCAGG + Intronic
981137980 4:141235095-141235117 TGTCAAAGTTAGAGGGCCTCTGG + Intergenic
981713753 4:147732928-147732950 GGTGAAGCTTAAGGGGACTCTGG - Intronic
983860587 4:172700966-172700988 TATGAAGCTTAAGGAGCCTGAGG + Intronic
985347591 4:189022917-189022939 TTTGCTGGTTAAGGGGCCTGTGG - Intergenic
987642943 5:20634493-20634515 TGTGCACGGTAAGGGGCCTGAGG + Intergenic
991188720 5:63843088-63843110 GCTGAAGGTTGAGGTGCCTCTGG - Intergenic
991441704 5:66657389-66657411 TTAGAATGTTAAGGGGTCTCTGG - Intronic
993572764 5:89562653-89562675 TGGGAAGATGAAAGGGCCTCTGG - Intergenic
1000240511 5:159404248-159404270 TGTGAAGGGTCTGGGGCATCTGG + Intergenic
1001122282 5:168990711-168990733 TGTGCAGGTACAGGGACCTCAGG + Intronic
1001419991 5:171579018-171579040 CTTGCAGGTTCAGGGGCCTCAGG + Intergenic
1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG + Intronic
1004017239 6:11743475-11743497 TGTGAAGGCCAAGGGGGCTGAGG - Intronic
1006187473 6:32189499-32189521 TGTGAAGGTTTCAGGGCCTGGGG + Intronic
1006503946 6:34476244-34476266 TGTGAAGGTGAAGGGGAGCCTGG - Intronic
1007527569 6:42509871-42509893 AGTGAACCTTAAGGGGCCTAGGG - Intergenic
1012973874 6:105758841-105758863 TGGGAAGCTTAAGCAGCCTCTGG + Intergenic
1014251160 6:119116860-119116882 TGTAAAGAGTAAGGGGCATCTGG + Intronic
1018841797 6:167522736-167522758 TGCGCTGGTTACGGGGCCTCGGG - Intergenic
1019664584 7:2245253-2245275 TGTGAGGGTTGAGGGGCGTCTGG - Intronic
1019732930 7:2637542-2637564 GGTGCAGGTTTAGGGGGCTCAGG + Intronic
1022295391 7:29046419-29046441 TTTGAAGGTTAAGTTGCCTTTGG - Intronic
1024064210 7:45719112-45719134 TGTGAAGGCAGAGGGGTCTCTGG + Exonic
1024232470 7:47373079-47373101 AGGGAAGGAGAAGGGGCCTCTGG + Intronic
1026447898 7:70501558-70501580 TGTGATGGTGAAAGGGCCTGAGG - Intronic
1027757393 7:82231395-82231417 TGTGAATGTTCTGAGGCCTCTGG - Intronic
1031088255 7:117324019-117324041 TGTGGAGGTTAAGGGACCCTCGG + Intergenic
1034656729 7:152735750-152735772 TGGGAAGGTTAAGGGGCACAGGG - Intergenic
1036579235 8:10057215-10057237 TGTTCAGGTTAGGGGGCATCTGG + Intronic
1037795100 8:21986528-21986550 TGTCAGGATTAAGGGACCTCTGG - Intronic
1038165595 8:25082479-25082501 TGTGAGGGAGATGGGGCCTCTGG + Intergenic
1038213261 8:25539504-25539526 TGTGGAGCTAAAGGGACCTCTGG - Intergenic
1038480894 8:27901309-27901331 TGGGAAGGTTGAAAGGCCTCGGG + Intronic
1052201375 9:25785388-25785410 TATGGAGGTTGGGGGGCCTCTGG + Intergenic
1055308153 9:74952076-74952098 TGTGTAGGTTAAGACGCCTGAGG - Intronic
1056595944 9:88007578-88007600 TGGGAAGGTGAAGAGGCGTCTGG + Intergenic
1057223180 9:93268683-93268705 GGCGAAGATTCAGGGGCCTCGGG - Exonic
1059004342 9:110384757-110384779 TGTGAAGGTCATGGGGATTCTGG - Intronic
1059417028 9:114168603-114168625 TGTGATGGTTGAGCGGCCGCAGG - Exonic
1061244048 9:129392204-129392226 TGTGACACTTAAGGGGCCCCAGG + Intergenic
1186407677 X:9318006-9318028 TGTGCAGGTCAAGGGGCCCAGGG - Intergenic
1189206957 X:39249433-39249455 TGTGAATGTTATGGGGACTGTGG + Intergenic
1191869331 X:65732527-65732549 TGTGATGGTTAAGTGGCTTTTGG + Intronic
1195715811 X:107817787-107817809 CCTGAAGGTTAATGTGCCTCAGG - Intergenic
1196157365 X:112445881-112445903 TGTGAAGGTTAACTTGCCTCAGG + Intergenic
1198491098 X:137142362-137142384 ATGGAAGGTTAAGGGGCTTCAGG - Intergenic
1200212810 X:154354414-154354436 TGACAAGGTCAAAGGGCCTCAGG + Exonic