ID: 902080496

View in Genome Browser
Species Human (GRCh38)
Location 1:13817468-13817490
Sequence TCTGCTGGTGACCCACGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902080492_902080496 7 Left 902080492 1:13817438-13817460 CCAGACTTTTCATTTTTGGAGTA 0: 1
1: 0
2: 1
3: 34
4: 324
Right 902080496 1:13817468-13817490 TCTGCTGGTGACCCACGAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902080496 Original CRISPR TCTGCTGGTGACCCACGAGC AGG Intronic
902080496 1:13817468-13817490 TCTGCTGGTGACCCACGAGCAGG + Intronic
902219403 1:14955360-14955382 CCTGCTGGTGGCCCCTGAGCTGG + Intronic
904416206 1:30362473-30362495 GCTGCTGTTGACCATCGAGCAGG - Intergenic
907667591 1:56447025-56447047 TCTGCTGATGAGCCCTGAGCTGG + Intergenic
911063780 1:93769875-93769897 TCTCCTGGTGGCCCACAAGTGGG - Intronic
918529282 1:185500344-185500366 TCAGCTGGTGTCCCATGACCTGG + Intergenic
920382938 1:205546245-205546267 TCTGCTGGGGAGCCAAGGGCTGG + Intergenic
920412280 1:205771674-205771696 TCTCAAGGTGACCCAAGAGCCGG + Intronic
922419900 1:225452368-225452390 TCTGCCCGTGGCCCCCGAGCTGG - Intergenic
922898231 1:229116945-229116967 TGTGCTGGTGACCAAGGAGTTGG - Intergenic
1062802867 10:393001-393023 TCTGCCGGTGACCCAAGGACGGG + Intronic
1069377071 10:67803889-67803911 TCTGTTGGTTACCCAAGAGATGG - Intronic
1076340938 10:129744456-129744478 TCTGCAGGTCACCCACTGGCTGG + Intronic
1076547749 10:131257207-131257229 TCTGCTGGAGACCCACTGCCTGG + Intronic
1076875190 10:133212499-133212521 TCAGCAGGTGCCCCACGGGCAGG - Intronic
1077177604 11:1197783-1197805 TCATCTGGAGACCCCCGAGCGGG + Intronic
1084170412 11:67398260-67398282 ACGGCTGGAGACCCACGACCTGG + Exonic
1091546040 12:1501911-1501933 TCTGCAGGGGACCCAAAAGCAGG - Intergenic
1096639955 12:52986228-52986250 TCTGCTGGAGAGCCACAGGCAGG - Intergenic
1112276143 13:98021939-98021961 TCTTCTGGAGAGCCACAAGCAGG + Exonic
1113521814 13:110946940-110946962 TCTGCTCGTGCCCCAGCAGCAGG - Intergenic
1117416889 14:55505068-55505090 CTTGCTGGTGACTCACTAGCTGG + Intergenic
1129364553 15:75046361-75046383 GCTGCTGCTGACCCGCCAGCAGG - Intronic
1130515303 15:84621740-84621762 TCCGCTGGTGCACTACGAGCTGG - Exonic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1136656686 16:31713445-31713467 TCTTCTGGGGACCCCCGACCTGG - Intronic
1136924673 16:34361075-34361097 TCAGCTGGTGTCCCAAGAGCGGG - Intergenic
1136979900 16:35050731-35050753 TCAGCTGGTGTCCCAAGAGCGGG + Intergenic
1137587156 16:49670468-49670490 GCTGCTGGTGACCCATGAAGTGG - Intronic
1137844930 16:51677885-51677907 TCTGCAGGTGTCCAATGAGCTGG - Intergenic
1139371040 16:66469666-66469688 TCTGCTCGTGTCCCCCGTGCTGG + Exonic
1143190132 17:5034561-5034583 TCTGGTGCTGACCCACCTGCTGG - Exonic
1143404730 17:6669755-6669777 TCAGCTGGTGATGCACCAGCTGG + Intergenic
1148860204 17:50600655-50600677 TCTGCTGAGGAGCCAGGAGCCGG + Intronic
1149609167 17:57947126-57947148 TCTCCTGGTGACCAGCAAGCTGG - Intronic
1150069632 17:62139990-62140012 TCTGCTGCTGACCTGAGAGCTGG + Intergenic
1152566740 17:81103687-81103709 CCTGCCGGTGCCCCCCGAGCTGG + Exonic
1160544438 18:79643342-79643364 TCTGCTGGGGACGCACCAGCTGG - Intergenic
1160728500 19:629689-629711 TCTGCTGCTGACCTGAGAGCTGG + Exonic
1161108577 19:2456288-2456310 CCTCCTGGAGACCCCCGAGCCGG + Intronic
1161948785 19:7455576-7455598 GGTCCTGGTGACCCAGGAGCAGG + Intronic
1162473885 19:10888358-10888380 TCAGCTGGGGACCCAGAAGCTGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163212645 19:15852512-15852534 TCGGATGGTGGCCCAGGAGCTGG - Intergenic
1166054540 19:40280492-40280514 TTAGCAGGTGACCCAGGAGCCGG - Intronic
1166803661 19:45472634-45472656 TGTGCTGGTGGCCCACAAACCGG + Exonic
1166882864 19:45939898-45939920 TCAGCGGGTCACCTACGAGCAGG - Exonic
930034526 2:47077121-47077143 TTTGATGATGACCCACGGGCAGG + Intronic
935268458 2:101414013-101414035 ACTCCTGGTAGCCCACGAGCCGG + Intronic
935433424 2:103002740-103002762 CTTGCTGGTGTCCCAGGAGCAGG - Intergenic
938262770 2:129907112-129907134 TCTGGTGGTGATAAACGAGCAGG + Intergenic
938934299 2:136115726-136115748 TCTTCTGGTAACCCATGACCAGG + Exonic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
947879073 2:233489309-233489331 TCTGCTGCTGACGCACTGGCTGG - Intronic
948614006 2:239186727-239186749 TCTTCTGGTGCCCCAGGAGCTGG - Intronic
1168767170 20:389467-389489 TCTGCTGCTGCCCCAGGAGGAGG - Intronic
1168827420 20:823140-823162 TCTGCTGGGGCCCCACAGGCAGG - Intergenic
1168962024 20:1876495-1876517 TGTGCTGGGCACCCAGGAGCCGG - Intergenic
1169124251 20:3115719-3115741 TCTGCAGTTGAGCCACGAGGTGG - Intronic
1169137139 20:3204105-3204127 TCTGCCTGTCCCCCACGAGCTGG - Intronic
1176159342 20:63640651-63640673 TCTGCCAGGGACCCATGAGCAGG - Exonic
1178115792 21:29415084-29415106 TCTGCTGGGGACCCACCACATGG - Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181635603 22:24172976-24172998 TCTCCTGGGGCCCCACCAGCTGG - Intronic
1181778853 22:25178623-25178645 TCTGCCAGGGACCCATGAGCAGG - Intronic
1182919282 22:34064674-34064696 TCAGCTGGTGACCCATGAGGAGG - Intergenic
1184019869 22:41813744-41813766 TCTGCAGATGGCCCAGGAGCTGG + Exonic
1184222845 22:43111495-43111517 CCTGCGGGTGACCCGCGAGGGGG + Intronic
1184386607 22:44180132-44180154 TCTGCTGGTTCACCATGAGCTGG + Intronic
1184803929 22:46779930-46779952 TCTGCTGTTGACCCTCGGGGTGG + Intronic
1185399465 22:50608413-50608435 TGTCCTGGTGACCCCAGAGCTGG - Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
956411171 3:68981304-68981326 TCTATTGGGGACCCATGAGCTGG - Intronic
965604632 3:170485952-170485974 TCTGCTGCTGCCCCAGGGGCTGG - Intronic
967915279 3:194573783-194573805 CCAGCTGGTGTCCCACGAGGAGG + Intergenic
972475635 4:39446868-39446890 CCTGCTGGTGGCCCACGCCCTGG + Exonic
973709704 4:53616370-53616392 TGTGCTGCTGACCCAGGCGCAGG - Intronic
985425690 4:189828344-189828366 TCTGCTGCAGAGCCACCAGCTGG + Intergenic
985979113 5:3447975-3447997 TATTTTGGTGACCCAAGAGCTGG + Intergenic
987265431 5:16248540-16248562 ACTGATGGTGACCCACTAGGGGG - Intergenic
989631086 5:43483619-43483641 GGTGCGTGTGACCCACGAGCCGG - Intronic
991369797 5:65906391-65906413 TCTGCTGGGCACACACCAGCTGG - Intergenic
992872172 5:81018169-81018191 TCAGTTGGTGCCCCACCAGCTGG + Intronic
996524273 5:124461259-124461281 TCTGTTGGTGACCTTCAAGCTGG + Intergenic
996937648 5:128966464-128966486 TCTGCTGATGAGCAATGAGCCGG + Exonic
997013482 5:129904980-129905002 TCTGCTGCTGGCCCCCGCGCCGG + Exonic
998535805 5:142929825-142929847 TTTGCTGGTGAGCCACTAGCAGG + Intronic
999968160 5:156832083-156832105 TGTCCTGGAGACCCACGACCTGG - Intergenic
1001208896 5:169791697-169791719 TCTGTTGGAGACACACTAGCTGG + Intronic
1003554499 6:7127796-7127818 TCTGCAGGTGAGCAGCGAGCTGG - Intronic
1005992764 6:30913851-30913873 GCTGCTGCTGGCCCACGCGCGGG + Exonic
1007137902 6:39540622-39540644 TCTGCTGCTGCCTCCCGAGCAGG - Intronic
1007615299 6:43176298-43176320 TCTTCAGTTGACCCAAGAGCTGG - Intronic
1016257023 6:142119390-142119412 TTGGCTGGTGCCCCAGGAGCTGG + Intergenic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1032499646 7:132390914-132390936 TTTGCTGGTGACTCAAAAGCCGG + Intronic
1035778435 8:2208481-2208503 TTGGCTGGTGACCCAGGAGATGG + Intergenic
1038981434 8:32763770-32763792 TCTACAGGTGACATACGAGCCGG - Exonic
1049456418 8:142693310-142693332 TCTGCTGGGGAGCCTGGAGCCGG - Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1050567102 9:6896871-6896893 TCTTCTGGTGTCCCTGGAGCAGG + Intronic
1053374538 9:37594015-37594037 TCTGCTGGTGATGCACGGGCAGG + Intronic
1057133360 9:92669907-92669929 CCTGGTGGTGGCCCACGCGCAGG - Exonic
1057503152 9:95611608-95611630 TCTGGAGGGGACCCAGGAGCTGG + Intergenic
1061078386 9:128355402-128355424 TGTGCTGGTGATGGACGAGCTGG + Exonic
1189966203 X:46376445-46376467 TCAGCTGTTGGCCCAGGAGCAGG - Intergenic
1190069380 X:47266827-47266849 TGTGCTGTTGTCCCAGGAGCCGG + Intergenic
1190077448 X:47328242-47328264 TGTGCTGTTGTCCCAGGAGCCGG - Intergenic
1192189173 X:68980308-68980330 TCTGCTGAGGAGCCATGAGCAGG - Intergenic