ID: 902086546

View in Genome Browser
Species Human (GRCh38)
Location 1:13867268-13867290
Sequence AGGTCTTTGCAGATGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902086546_902086554 30 Left 902086546 1:13867268-13867290 CCTGACTACATCTGCAAAGACCT No data
Right 902086554 1:13867321-13867343 CCGGGCAGACATGGATTTTTTGG No data
902086546_902086551 12 Left 902086546 1:13867268-13867290 CCTGACTACATCTGCAAAGACCT No data
Right 902086551 1:13867303-13867325 AGGTCACATTCACAGTTTCCGGG No data
902086546_902086550 11 Left 902086546 1:13867268-13867290 CCTGACTACATCTGCAAAGACCT No data
Right 902086550 1:13867302-13867324 AAGGTCACATTCACAGTTTCCGG No data
902086546_902086552 21 Left 902086546 1:13867268-13867290 CCTGACTACATCTGCAAAGACCT No data
Right 902086552 1:13867312-13867334 TCACAGTTTCCGGGCAGACATGG No data
902086546_902086547 -8 Left 902086546 1:13867268-13867290 CCTGACTACATCTGCAAAGACCT No data
Right 902086547 1:13867283-13867305 AAAGACCTCATTTCCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902086546 Original CRISPR AGGTCTTTGCAGATGTAGTC AGG (reversed) Intergenic
No off target data available for this crispr