ID: 902088025

View in Genome Browser
Species Human (GRCh38)
Location 1:13878125-13878147
Sequence CACACGACACGGACCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902088025_902088033 26 Left 902088025 1:13878125-13878147 CCCCAGGAGGTCCGTGTCGTGTG No data
Right 902088033 1:13878174-13878196 AATCACAGATGCCTTCTACATGG No data
902088025_902088030 2 Left 902088025 1:13878125-13878147 CCCCAGGAGGTCCGTGTCGTGTG No data
Right 902088030 1:13878150-13878172 ACACAGACCTCGACCTACTCGGG No data
902088025_902088029 1 Left 902088025 1:13878125-13878147 CCCCAGGAGGTCCGTGTCGTGTG No data
Right 902088029 1:13878149-13878171 GACACAGACCTCGACCTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902088025 Original CRISPR CACACGACACGGACCTCCTG GGG (reversed) Intergenic