ID: 902088029

View in Genome Browser
Species Human (GRCh38)
Location 1:13878149-13878171
Sequence GACACAGACCTCGACCTACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902088020_902088029 20 Left 902088020 1:13878106-13878128 CCGATCAAAACCTGAGTTCCCCC No data
Right 902088029 1:13878149-13878171 GACACAGACCTCGACCTACTCGG No data
902088023_902088029 10 Left 902088023 1:13878116-13878138 CCTGAGTTCCCCCAGGAGGTCCG No data
Right 902088029 1:13878149-13878171 GACACAGACCTCGACCTACTCGG No data
902088026_902088029 0 Left 902088026 1:13878126-13878148 CCCAGGAGGTCCGTGTCGTGTGT No data
Right 902088029 1:13878149-13878171 GACACAGACCTCGACCTACTCGG No data
902088027_902088029 -1 Left 902088027 1:13878127-13878149 CCAGGAGGTCCGTGTCGTGTGTG No data
Right 902088029 1:13878149-13878171 GACACAGACCTCGACCTACTCGG No data
902088025_902088029 1 Left 902088025 1:13878125-13878147 CCCCAGGAGGTCCGTGTCGTGTG No data
Right 902088029 1:13878149-13878171 GACACAGACCTCGACCTACTCGG No data
902088028_902088029 -10 Left 902088028 1:13878136-13878158 CCGTGTCGTGTGTGACACAGACC No data
Right 902088029 1:13878149-13878171 GACACAGACCTCGACCTACTCGG No data
902088024_902088029 2 Left 902088024 1:13878124-13878146 CCCCCAGGAGGTCCGTGTCGTGT No data
Right 902088029 1:13878149-13878171 GACACAGACCTCGACCTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902088029 Original CRISPR GACACAGACCTCGACCTACT CGG Intergenic