ID: 902088033

View in Genome Browser
Species Human (GRCh38)
Location 1:13878174-13878196
Sequence AATCACAGATGCCTTCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902088028_902088033 15 Left 902088028 1:13878136-13878158 CCGTGTCGTGTGTGACACAGACC No data
Right 902088033 1:13878174-13878196 AATCACAGATGCCTTCTACATGG No data
902088026_902088033 25 Left 902088026 1:13878126-13878148 CCCAGGAGGTCCGTGTCGTGTGT No data
Right 902088033 1:13878174-13878196 AATCACAGATGCCTTCTACATGG No data
902088027_902088033 24 Left 902088027 1:13878127-13878149 CCAGGAGGTCCGTGTCGTGTGTG No data
Right 902088033 1:13878174-13878196 AATCACAGATGCCTTCTACATGG No data
902088024_902088033 27 Left 902088024 1:13878124-13878146 CCCCCAGGAGGTCCGTGTCGTGT No data
Right 902088033 1:13878174-13878196 AATCACAGATGCCTTCTACATGG No data
902088031_902088033 -6 Left 902088031 1:13878157-13878179 CCTCGACCTACTCGGGCAATCAC No data
Right 902088033 1:13878174-13878196 AATCACAGATGCCTTCTACATGG No data
902088025_902088033 26 Left 902088025 1:13878125-13878147 CCCCAGGAGGTCCGTGTCGTGTG No data
Right 902088033 1:13878174-13878196 AATCACAGATGCCTTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902088033 Original CRISPR AATCACAGATGCCTTCTACA TGG Intergenic