ID: 902089680

View in Genome Browser
Species Human (GRCh38)
Location 1:13893216-13893238
Sequence AGAGCGCTGCCCAGGCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902089680_902089688 8 Left 902089680 1:13893216-13893238 CCGCGGGGCCTGGGCAGCGCTCT No data
Right 902089688 1:13893247-13893269 CTGGTGCTGGAACACAGCCGGGG No data
902089680_902089692 25 Left 902089680 1:13893216-13893238 CCGCGGGGCCTGGGCAGCGCTCT No data
Right 902089692 1:13893264-13893286 CCGGGGCTGAGCTGCTCCCGGGG No data
902089680_902089684 -5 Left 902089680 1:13893216-13893238 CCGCGGGGCCTGGGCAGCGCTCT No data
Right 902089684 1:13893234-13893256 GCTCTGCCGGCAGCTGGTGCTGG No data
902089680_902089686 6 Left 902089680 1:13893216-13893238 CCGCGGGGCCTGGGCAGCGCTCT No data
Right 902089686 1:13893245-13893267 AGCTGGTGCTGGAACACAGCCGG No data
902089680_902089690 24 Left 902089680 1:13893216-13893238 CCGCGGGGCCTGGGCAGCGCTCT No data
Right 902089690 1:13893263-13893285 GCCGGGGCTGAGCTGCTCCCGGG No data
902089680_902089687 7 Left 902089680 1:13893216-13893238 CCGCGGGGCCTGGGCAGCGCTCT No data
Right 902089687 1:13893246-13893268 GCTGGTGCTGGAACACAGCCGGG No data
902089680_902089689 23 Left 902089680 1:13893216-13893238 CCGCGGGGCCTGGGCAGCGCTCT No data
Right 902089689 1:13893262-13893284 AGCCGGGGCTGAGCTGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902089680 Original CRISPR AGAGCGCTGCCCAGGCCCCG CGG (reversed) Intergenic
No off target data available for this crispr