ID: 902096314

View in Genome Browser
Species Human (GRCh38)
Location 1:13948801-13948823
Sequence CCTGTTTTGCTGTTATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902096312_902096314 -3 Left 902096312 1:13948781-13948803 CCTCAGAAGTATTGCTGGCTCCT No data
Right 902096314 1:13948801-13948823 CCTGTTTTGCTGTTATTTTCAGG No data
902096309_902096314 30 Left 902096309 1:13948748-13948770 CCTGGTTTTCATTCTGTATCTCT No data
Right 902096314 1:13948801-13948823 CCTGTTTTGCTGTTATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902096314 Original CRISPR CCTGTTTTGCTGTTATTTTC AGG Intergenic
No off target data available for this crispr