ID: 902099364

View in Genome Browser
Species Human (GRCh38)
Location 1:13973278-13973300
Sequence CAGTGGATCTAGAGGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902099364_902099372 10 Left 902099364 1:13973278-13973300 CCCTTTCCCCTCTAGATCCACTG No data
Right 902099372 1:13973311-13973333 TCCACCCTGCTTTATTCCCTAGG No data
902099364_902099374 13 Left 902099364 1:13973278-13973300 CCCTTTCCCCTCTAGATCCACTG No data
Right 902099374 1:13973314-13973336 ACCCTGCTTTATTCCCTAGGAGG No data
902099364_902099378 26 Left 902099364 1:13973278-13973300 CCCTTTCCCCTCTAGATCCACTG No data
Right 902099378 1:13973327-13973349 CCCTAGGAGGCTGACCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902099364 Original CRISPR CAGTGGATCTAGAGGGGAAA GGG (reversed) Intergenic
No off target data available for this crispr