ID: 902099375

View in Genome Browser
Species Human (GRCh38)
Location 1:13973315-13973337
Sequence GCCTCCTAGGGAATAAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902099375_902099386 30 Left 902099375 1:13973315-13973337 CCCTGCTTTATTCCCTAGGAGGC No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data
902099375_902099384 19 Left 902099375 1:13973315-13973337 CCCTGCTTTATTCCCTAGGAGGC No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902099375 Original CRISPR GCCTCCTAGGGAATAAAGCA GGG (reversed) Intergenic
No off target data available for this crispr