ID: 902099384

View in Genome Browser
Species Human (GRCh38)
Location 1:13973357-13973379
Sequence TAGCTGTCTTCCTTACTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902099371_902099384 28 Left 902099371 1:13973306-13973328 CCTTCTCCACCCTGCTTTATTCC No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099373_902099384 22 Left 902099373 1:13973312-13973334 CCACCCTGCTTTATTCCCTAGGA No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099382_902099384 -9 Left 902099382 1:13973343-13973365 CCTGTGGACCTCATTAGCTGTCT No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099370_902099384 29 Left 902099370 1:13973305-13973327 CCCTTCTCCACCCTGCTTTATTC No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099376_902099384 18 Left 902099376 1:13973316-13973338 CCTGCTTTATTCCCTAGGAGGCT No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099377_902099384 7 Left 902099377 1:13973327-13973349 CCCTAGGAGGCTGACCCCTGTGG No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099379_902099384 6 Left 902099379 1:13973328-13973350 CCTAGGAGGCTGACCCCTGTGGA No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099380_902099384 -7 Left 902099380 1:13973341-13973363 CCCCTGTGGACCTCATTAGCTGT No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099381_902099384 -8 Left 902099381 1:13973342-13973364 CCCTGTGGACCTCATTAGCTGTC No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data
902099375_902099384 19 Left 902099375 1:13973315-13973337 CCCTGCTTTATTCCCTAGGAGGC No data
Right 902099384 1:13973357-13973379 TAGCTGTCTTCCTTACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902099384 Original CRISPR TAGCTGTCTTCCTTACTTTC AGG Intergenic
No off target data available for this crispr