ID: 902099386

View in Genome Browser
Species Human (GRCh38)
Location 1:13973368-13973390
Sequence CTTACTTTCAGGTGTCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902099382_902099386 2 Left 902099382 1:13973343-13973365 CCTGTGGACCTCATTAGCTGTCT No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data
902099377_902099386 18 Left 902099377 1:13973327-13973349 CCCTAGGAGGCTGACCCCTGTGG No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data
902099381_902099386 3 Left 902099381 1:13973342-13973364 CCCTGTGGACCTCATTAGCTGTC No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data
902099375_902099386 30 Left 902099375 1:13973315-13973337 CCCTGCTTTATTCCCTAGGAGGC No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data
902099376_902099386 29 Left 902099376 1:13973316-13973338 CCTGCTTTATTCCCTAGGAGGCT No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data
902099379_902099386 17 Left 902099379 1:13973328-13973350 CCTAGGAGGCTGACCCCTGTGGA No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data
902099383_902099386 -6 Left 902099383 1:13973351-13973373 CCTCATTAGCTGTCTTCCTTACT No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data
902099380_902099386 4 Left 902099380 1:13973341-13973363 CCCCTGTGGACCTCATTAGCTGT No data
Right 902099386 1:13973368-13973390 CTTACTTTCAGGTGTCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902099386 Original CRISPR CTTACTTTCAGGTGTCTAGT TGG Intergenic
No off target data available for this crispr