ID: 902100190

View in Genome Browser
Species Human (GRCh38)
Location 1:13982017-13982039
Sequence GGTGGGAATCAACATTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902100190_902100193 -3 Left 902100190 1:13982017-13982039 CCACTTCAATGTTGATTCCCACC No data
Right 902100193 1:13982037-13982059 ACCCCTCAGAGAATAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902100190 Original CRISPR GGTGGGAATCAACATTGAAG TGG (reversed) Intergenic
No off target data available for this crispr