ID: 902100769

View in Genome Browser
Species Human (GRCh38)
Location 1:13986761-13986783
Sequence TCCTTCCTCTATAGAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902100769_902100771 -7 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100771 1:13986777-13986799 GGAAGGAGAAACCAGCCACCGGG No data
902100769_902100772 -6 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100772 1:13986778-13986800 GAAGGAGAAACCAGCCACCGGGG No data
902100769_902100778 21 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100778 1:13986805-13986827 CGTGTCTAGACAGCAGTGCCAGG No data
902100769_902100780 29 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100780 1:13986813-13986835 GACAGCAGTGCCAGGACATTGGG No data
902100769_902100770 -8 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100770 1:13986776-13986798 AGGAAGGAGAAACCAGCCACCGG No data
902100769_902100779 28 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG No data
902100769_902100781 30 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902100769 Original CRISPR TCCTTCCTCTATAGAGATAC TGG (reversed) Intergenic