ID: 902100773

View in Genome Browser
Species Human (GRCh38)
Location 1:13986788-13986810
Sequence GACACGAGGGCCCCGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902100773_902100779 1 Left 902100773 1:13986788-13986810 CCAGCCACCGGGGCCCTCGTGTC No data
Right 902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG No data
902100773_902100778 -6 Left 902100773 1:13986788-13986810 CCAGCCACCGGGGCCCTCGTGTC No data
Right 902100778 1:13986805-13986827 CGTGTCTAGACAGCAGTGCCAGG No data
902100773_902100781 3 Left 902100773 1:13986788-13986810 CCAGCCACCGGGGCCCTCGTGTC No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data
902100773_902100780 2 Left 902100773 1:13986788-13986810 CCAGCCACCGGGGCCCTCGTGTC No data
Right 902100780 1:13986813-13986835 GACAGCAGTGCCAGGACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902100773 Original CRISPR GACACGAGGGCCCCGGTGGC TGG (reversed) Intergenic