ID: 902100774

View in Genome Browser
Species Human (GRCh38)
Location 1:13986792-13986814
Sequence TCTAGACACGAGGGCCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902100774_902100780 -2 Left 902100774 1:13986792-13986814 CCACCGGGGCCCTCGTGTCTAGA No data
Right 902100780 1:13986813-13986835 GACAGCAGTGCCAGGACATTGGG No data
902100774_902100781 -1 Left 902100774 1:13986792-13986814 CCACCGGGGCCCTCGTGTCTAGA No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data
902100774_902100779 -3 Left 902100774 1:13986792-13986814 CCACCGGGGCCCTCGTGTCTAGA No data
Right 902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG No data
902100774_902100778 -10 Left 902100774 1:13986792-13986814 CCACCGGGGCCCTCGTGTCTAGA No data
Right 902100778 1:13986805-13986827 CGTGTCTAGACAGCAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902100774 Original CRISPR TCTAGACACGAGGGCCCCGG TGG (reversed) Intergenic
No off target data available for this crispr