ID: 902100775

View in Genome Browser
Species Human (GRCh38)
Location 1:13986795-13986817
Sequence CTGTCTAGACACGAGGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902100775_902100780 -5 Left 902100775 1:13986795-13986817 CCGGGGCCCTCGTGTCTAGACAG No data
Right 902100780 1:13986813-13986835 GACAGCAGTGCCAGGACATTGGG No data
902100775_902100781 -4 Left 902100775 1:13986795-13986817 CCGGGGCCCTCGTGTCTAGACAG No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data
902100775_902100779 -6 Left 902100775 1:13986795-13986817 CCGGGGCCCTCGTGTCTAGACAG No data
Right 902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902100775 Original CRISPR CTGTCTAGACACGAGGGCCC CGG (reversed) Intergenic