ID: 902100779

View in Genome Browser
Species Human (GRCh38)
Location 1:13986812-13986834
Sequence AGACAGCAGTGCCAGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902100774_902100779 -3 Left 902100774 1:13986792-13986814 CCACCGGGGCCCTCGTGTCTAGA No data
Right 902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG No data
902100775_902100779 -6 Left 902100775 1:13986795-13986817 CCGGGGCCCTCGTGTCTAGACAG No data
Right 902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG No data
902100769_902100779 28 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG No data
902100773_902100779 1 Left 902100773 1:13986788-13986810 CCAGCCACCGGGGCCCTCGTGTC No data
Right 902100779 1:13986812-13986834 AGACAGCAGTGCCAGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902100779 Original CRISPR AGACAGCAGTGCCAGGACAT TGG Intergenic