ID: 902100780

View in Genome Browser
Species Human (GRCh38)
Location 1:13986813-13986835
Sequence GACAGCAGTGCCAGGACATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902100769_902100780 29 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100780 1:13986813-13986835 GACAGCAGTGCCAGGACATTGGG No data
902100773_902100780 2 Left 902100773 1:13986788-13986810 CCAGCCACCGGGGCCCTCGTGTC No data
Right 902100780 1:13986813-13986835 GACAGCAGTGCCAGGACATTGGG No data
902100774_902100780 -2 Left 902100774 1:13986792-13986814 CCACCGGGGCCCTCGTGTCTAGA No data
Right 902100780 1:13986813-13986835 GACAGCAGTGCCAGGACATTGGG No data
902100775_902100780 -5 Left 902100775 1:13986795-13986817 CCGGGGCCCTCGTGTCTAGACAG No data
Right 902100780 1:13986813-13986835 GACAGCAGTGCCAGGACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902100780 Original CRISPR GACAGCAGTGCCAGGACATT GGG Intergenic
No off target data available for this crispr