ID: 902100781

View in Genome Browser
Species Human (GRCh38)
Location 1:13986814-13986836
Sequence ACAGCAGTGCCAGGACATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902100774_902100781 -1 Left 902100774 1:13986792-13986814 CCACCGGGGCCCTCGTGTCTAGA No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data
902100776_902100781 -10 Left 902100776 1:13986801-13986823 CCCTCGTGTCTAGACAGCAGTGC No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data
902100769_902100781 30 Left 902100769 1:13986761-13986783 CCAGTATCTCTATAGAGGAAGGA No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data
902100775_902100781 -4 Left 902100775 1:13986795-13986817 CCGGGGCCCTCGTGTCTAGACAG No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data
902100773_902100781 3 Left 902100773 1:13986788-13986810 CCAGCCACCGGGGCCCTCGTGTC No data
Right 902100781 1:13986814-13986836 ACAGCAGTGCCAGGACATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902100781 Original CRISPR ACAGCAGTGCCAGGACATTG GGG Intergenic
No off target data available for this crispr