ID: 902101861

View in Genome Browser
Species Human (GRCh38)
Location 1:13996834-13996856
Sequence TGACTGTCCCTTTGCGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902101861_902101868 22 Left 902101861 1:13996834-13996856 CCCCCTCCGCAAAGGGACAGTCA No data
Right 902101868 1:13996879-13996901 TGTTCCCTCTGCCACCCAACTGG No data
902101861_902101866 -4 Left 902101861 1:13996834-13996856 CCCCCTCCGCAAAGGGACAGTCA No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902101861 Original CRISPR TGACTGTCCCTTTGCGGAGG GGG (reversed) Intergenic
No off target data available for this crispr