ID: 902101866

View in Genome Browser
Species Human (GRCh38)
Location 1:13996853-13996875
Sequence GTCAAAGTACTTTGTTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902101855_902101866 13 Left 902101855 1:13996817-13996839 CCCCAAGCGAAGCACACCCCCCT No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101862_902101866 -5 Left 902101862 1:13996835-13996857 CCCCTCCGCAAAGGGACAGTCAA No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101856_902101866 12 Left 902101856 1:13996818-13996840 CCCAAGCGAAGCACACCCCCCTC No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101864_902101866 -7 Left 902101864 1:13996837-13996859 CCTCCGCAAAGGGACAGTCAAAG No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101854_902101866 14 Left 902101854 1:13996816-13996838 CCCCCAAGCGAAGCACACCCCCC No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101860_902101866 -3 Left 902101860 1:13996833-13996855 CCCCCCTCCGCAAAGGGACAGTC No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101857_902101866 11 Left 902101857 1:13996819-13996841 CCAAGCGAAGCACACCCCCCTCC No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101863_902101866 -6 Left 902101863 1:13996836-13996858 CCCTCCGCAAAGGGACAGTCAAA No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101865_902101866 -10 Left 902101865 1:13996840-13996862 CCGCAAAGGGACAGTCAAAGTAC No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101853_902101866 15 Left 902101853 1:13996815-13996837 CCCCCCAAGCGAAGCACACCCCC No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data
902101861_902101866 -4 Left 902101861 1:13996834-13996856 CCCCCTCCGCAAAGGGACAGTCA No data
Right 902101866 1:13996853-13996875 GTCAAAGTACTTTGTTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902101866 Original CRISPR GTCAAAGTACTTTGTTAAAC AGG Intergenic
No off target data available for this crispr