ID: 902101868

View in Genome Browser
Species Human (GRCh38)
Location 1:13996879-13996901
Sequence TGTTCCCTCTGCCACCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902101860_902101868 23 Left 902101860 1:13996833-13996855 CCCCCCTCCGCAAAGGGACAGTC No data
Right 902101868 1:13996879-13996901 TGTTCCCTCTGCCACCCAACTGG No data
902101865_902101868 16 Left 902101865 1:13996840-13996862 CCGCAAAGGGACAGTCAAAGTAC No data
Right 902101868 1:13996879-13996901 TGTTCCCTCTGCCACCCAACTGG No data
902101862_902101868 21 Left 902101862 1:13996835-13996857 CCCCTCCGCAAAGGGACAGTCAA No data
Right 902101868 1:13996879-13996901 TGTTCCCTCTGCCACCCAACTGG No data
902101863_902101868 20 Left 902101863 1:13996836-13996858 CCCTCCGCAAAGGGACAGTCAAA No data
Right 902101868 1:13996879-13996901 TGTTCCCTCTGCCACCCAACTGG No data
902101864_902101868 19 Left 902101864 1:13996837-13996859 CCTCCGCAAAGGGACAGTCAAAG No data
Right 902101868 1:13996879-13996901 TGTTCCCTCTGCCACCCAACTGG No data
902101861_902101868 22 Left 902101861 1:13996834-13996856 CCCCCTCCGCAAAGGGACAGTCA No data
Right 902101868 1:13996879-13996901 TGTTCCCTCTGCCACCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902101868 Original CRISPR TGTTCCCTCTGCCACCCAAC TGG Intergenic
No off target data available for this crispr