ID: 902104690

View in Genome Browser
Species Human (GRCh38)
Location 1:14024706-14024728
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902104683_902104690 4 Left 902104683 1:14024679-14024701 CCAAGCTGGTAGGGTTTGGCAGT No data
Right 902104690 1:14024706-14024728 GTGTGGGATAAACCCAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr