ID: 902105916

View in Genome Browser
Species Human (GRCh38)
Location 1:14035951-14035973
Sequence CAGGCTCAGGCTTCAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902105911_902105916 -5 Left 902105911 1:14035933-14035955 CCTAGGATTATCCCTTGGCAGGC No data
Right 902105916 1:14035951-14035973 CAGGCTCAGGCTTCAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902105916 Original CRISPR CAGGCTCAGGCTTCAGGCTG AGG Intergenic
No off target data available for this crispr